Down syndrome in humans is due to Select one: O a. three X chromosomes O b. monosomy O c. O d. O e. one copy of chromosome X two Y chromosomes three copies of chromosome 21
Q: What cell component carries out translation?
A: Translation is synthesis of proteins in a specific amino acid sequence from mRNA. It begins with the…
Q: Describe the evolutionary history of snails (Molluscs). In which eon, era and period did the first…
A: The Arthropoda, whose members are referred to as molluscs or mollusks, make up the biggest phylum of…
Q: Transcribe the strand below: ACGCTACCGTTAGCCGACATCGGGGACACTGACTCG
A: A DNA fragment is copied into RNA during transcription. Messenger RNA is the term for DNA segments…
Q: MORPHOLOGICAL CHARACTER LIST OF CALAMANSI (PHILIPPINE LIME). pls answer it completely. a. Leaf…
A: Morphological characteristics of Calamansi (Philippine Lime): Calamansi, also known as calamondin,…
Q: A 25-year-old soldier suffers a gunshot wound on the lower part of his back and is unable to move…
A: Cauda equina or conus injuries have the potential to cause lower motor neuron damage. A bundle of…
Q: 2 Wolves are introduced into the park → The number of elk calves born to every 100 female elk …
A: Territoriality(space) can help to control population increase; an animal's home range is the region…
Q: The underlying structure of DNA is very simple, consisting of only four possible building blocks. a.…
A: DNA holds an individual's genetic information, as stated in the introduction. Phosphate, nitrogenous…
Q: For a chi-squared analysis, how many unpouched kangaroos with skinny tails do you expect?
A: Given information Pouched kangaroos are represented by P and are dominant over unpouched kangaroos,…
Q: Is the removal of large portions of the bark of trees known for their medicinal value beneficial or…
A: The functionality or structure of plants is the subject of the botany subdiscipline known as plant…
Q: When separating proteins from cellular extractions, what electrophoresis method works best and what…
A: Proteins are one of the most important biomolecule in our bodies.If we want to extract proteins,we…
Q: The scientists want to use the data to explain that the wolf population in Yellowstone reached…
A: Wolves are extremely social animals that live in packs. Each member of the pack has a unique…
Q: in 1995, a population of 31 gray wolves was introduced into Yellowstone National Park. The…
A: Some species live in unique climatic conditions since every living thing developed to exist in a…
Q: Explain how the exon/intron structure of genes contributes to the generation of new gene functions…
A: The genetic coding for the triplets contains the genes. The information encoded within the genetic…
Q: Which is mandatory for speciation to occur? • reproductive isolation • migration •divergence in…
A: Definition of speciation: Speciation is basically evolution of multiple species just from one…
Q: Regarding the Endocrine System, describe the regulation of short term and long term stress response.…
A: Please follow step 2 for detailed explanation.
Q: You performed a Genome-Wide Association Study (GWAS) attempting to link genotypes to the likelihood…
A: An odds ratio (OR) calculates the likelihood that an exposure will result in a particular result.…
Q: Diversification of species can be driven by factors such as physiological or morphological features…
A: The acquisition of new species through diversification and their removal through extinction…
Q: 1.Write the differences between nervous (autonomic) regulation and the humoral one. Humoral…
A: Introduction Immune system is a complex network of biological processes that defend an organism…
Q: Select all the true statements about ion exchange chromatography Group of answer choices In anion…
A: ion exchange chromatography is a process of ion separation that is based upon their affinity to ion…
Q: If you have a friend or family member working at a high risk of a silicosis exposure-related…
A: Workers who breathe in crystalline silica experience fibrotic nodules and damage around the…
Q: U.We can largely (more than 50 %) reduce the risk of cancer if we carefully avoid smoking,…
A: Cancer can be described as a group of diseases,in which cell lost the usual control over their…
Q: Discuss amongst yourselves the ethical principles at stake when faced with a moral dilemma and the…
A: HIPPA Law: HIPPA law is an act that is referred as Health Insurance Portability and Accountability…
Q: What are the main organs of the endocrine system and the functions of each organ
A: The endocrine system is a complex system that contains several glands and organs those plays an…
Q: GWAS and PheWAS experiments both aim to link genotypes and phenotypes, albeit using slightly…
A: GWAS (genome-wide association studies) are used to identify genetic variants associated with a…
Q: State the function of the digestive system in animals Describe how plants obtain their nutrients for…
A: In order to maintain cellular processes, animals must break down macromolecules into simple…
Q: The correct description of altruism by kin selection is that O An individual helps because all of…
A: The coefficient of relatedness (r) is a measure of how related two individuals are. It is usually…
Q: 53. Which of the following is a genetic disorder caused by a mutation in only a single nucleotide…
A: Sickle cell anemia - It is a genetic disorder that causes red blood cells to become sickle shaped…
Q: Plant bio
A: In the initial step of photosynthesis, solar energy is transformed into chemical energy in the form…
Q: How is epigenetic information similar to and different from genetic information? What attributes of…
A: In order to comprehend the form and composition of the genetic sequences and of the resulting…
Q: Match the letter on the tree of life below to the description. Animals Fungi Plants Protists Archaea…
A: Inroduction In five kingdom classification there are five kingdoms, monera, protists, fungi, plant…
Q: What mutations would have the greatest effect on peptide sequence? Which would have the least…
A: Introduction A mutation is a rapid, heritable alteration in an individual's phenotype. A mutation is…
Q: How many different proteins composed of 100 amino acids could possibly exist?
A: Amino acids are molecules that combine to make proteins. Hence, they are referred to as protein…
Q: Why is untreated pyelonephritis dangerous?
A: Pyelonephritis is an infection of the kidneys. The word may be broken down to Pylos + Nephros +…
Q: Which of the following reactions does not occur mammals? O pyruvate + NADH-lactate + NAD+ O…
A: Introduction : All chemical processes necessary to keep cells and an organism in a live state…
Q: The risk of Cancer increases as body mass increases. Determining right and wrong
A: Cancer: The uneven multiplication of cells inside the body which can, later on, evade the…
Q: reflective ward be green II. Extract chlorophyll from geranium leaves by boiling in ethanol until…
A: Chlorophyll The green pigment found in plants is called . It aids in the production of starch…
Q: DNA replication is critical to the growth of microbes. Describe the mechanism used by prokaryotes to…
A: DNA polymerase III replicates prokaryotic DNA at a rate of 1000 nucleotides per second in the 5′ to…
Q: Explain the difference between the actions of water-soluble and lipid-soluble hormones. Your…
A: Hormones are chemical messenger that are produced by the endocrine glands and directly released into…
Q: Three tests conducted to determine the safety to the environment of Bt corn.
A: Environmental research is done on invertebrates, animals, and bird species. The wild animal…
Q: Explain how "protein homology" is related to "gene homology". (Hint: how does a protein sequence…
A: Proteins are made up of amino acids that are bounded together by peptide bonds. They are synthesized…
Q: bacitracin on blood agar
A: Various microbes exhibit different biochemical tests which are then used to detect their presence or…
Q: In what type of species interaction are both species negatively effected. Briefly describe an…
A: In a natural habitat, the co-inhabiting organisms interact with one another to exert their…
Q: Domestic dogs would least likely meet the definition of a single species using which concept? Group…
A: Domestic dogs are dogs that have been tamed and trained by humans. All domestic dogs are related to…
Q: For these organisms to develop into functional offspring of that species, which one of the following…
A: Introduction Embryology is a branch of science which deals with the study of embryonic development.…
Q: To reach the native state, the unfolded state has to go through a _____________ state which is more…
A: Protein folding is a complex process which involves the formation of a functional protein from a…
Q: Regarding the Endocrine System, describe the role of insulin and glucagon in blood sugar.
A: Insulin and Glucagon are two major hormones of our bodies.These two hormones can play important…
Q: Experiment I: Scientists took two types of human epithelial cells and placed them in an experimental…
A: Active transport is the movement of molecules against their concentration gradient across the plasma…
Q: Genes encoding toxins are often located on plasmids. A recent outbreak has just occurred in which a…
A: The plasmids are little circular DNA pieces that are distinct from chromosomal DNA. They are mainly…
Q: How will transcription of the E. coli trp (tryptophan) operon be affected by the following…
A: Bacterial biosynthetic operon expression is controlled by the attenuator. It is a conditional…
Q: Drag and drop each structure or characteristic to the correct intestine. Small intestine Absorbs…
A: Small intestine and large intestine is the part of digestive track of human body.
Help me
Step by step
Solved in 2 steps
- The size of the deleted chromosomal piece O a. is correlated with cytoplasmic streaming only O b.determines the severity of the genetic disorder O c. none of these O d.is usually associated only with genic (base pair) mutations e. is replaced through normal meiosisMatch the chromosome terms appropriately. ___ polyploid a. symptoms of a genetic disorder ___ deletion b. chromosomal mashup ___ aneuploidy c. extra sets of chromosomes ___ translocation d. gets around ___ syndrome e. a chromosome segment lost ___ transposable element f. one extra chromosome ___ X-linked g. allele on the X chromosomeAn abnormality in which there is one more or one fewer than the normal number of chromosomes is called (a) a karyotype (b) a fragile site (c) an aneuploidy (d) trisomy (e) a translocation
- Alternative forms of the same gene are called _________ . a. gametes c. alleles b. homologous d. sister chromatidsFor each of the terms in the left column, choose thebest matching phrase in the right column.a. reciprocal translocation 1. lacking one or morechromosomes or having oneor more extra chromosomesb. gynandromorph 2. movement of short DNAelementsc. pericentric 3. having more than two completesets of chromosomesd. paracentric 4. exact exchange of parts of twononhomologous chromosomese. euploids 5. excluding the centromeref. polyploidy 6. including the centromereg. transposition 7. having complete sets ofchromosomesh. aneuploids 8. mosaic combination of maleand female tissueTwo chromosomes have the ff. order of genes: Normal A B centromere C D E F G H I Abnormal a b centromere g f e d c h i a. Does the abnormal chromosome have a pericentric or paracentric inversion? Why? b. Draw a sketch to show how these two chromosomes (duplicated) would pair during synapsis. Assume a CO will occur between genes E and F. What gametes are ultimately formed at the end of telophase II and describe.
- During the observation of a baby the diagnosis of Down's syndrome was made. What is the main cause of this pathology? Select one: a. Trisomy on the 13-th chromosome. b. Trisomy on the 21-st chromosome. c. Trisomy on X chromosome. d. Monosomy on the 1-st chromosome. O e. Undivergence of sex chromosomes.Which of the following is false regarding Down Syndrome? O can be caused by a Robertsonian translocation which is the fusion of the q arm of chromosome 21 with the q arm of chromosome O can be caused by a nondisjunction event O can be caused by equal exchange of chromatids during crossing over O Down syndrome individuals could possibly have normal childrenWhich types of mutations cause (1 word) a. Increase amount of genetic material in particular chromosome b increase amount of genetic material in all chromosomes c decreased amount of generic material in particular chromsomes d change to position of dna sequence in singular chromosome without changing the amount of genetic material e move dna from one chromosome to non homologous chromosome
- In humans, the number of chromosomes per set is 23. Even thoughthe following conditions are lethal, what would be the total numberof chromosomes for an individual with each condition?A. Trisomy 22B. Monosomy 11C. Triploidy1. Given: Adult diploid cell (2n = 8) 2. Illustrate the condition of the chromosomes during the following events in Meiosis: a. prophase I b. anaphase I c. telophase I d. prophase II e. metaphase II f. anaphase II g. daughter cells at end of telophase II/cytokinesis1. Which changes in chromosome structure cause a change in the total amount of genetic material, and which do not? 2. How does a chromosomal duplication occur? 3. An inversion heterozygote has the following inverted chromosome: B What would be the products if a crossover occurred between the genes F and E on the inverted chromosome and the normal chromosome? 4. An individual has the following reciprocal translocation: с D Centromere A B JI HGF ED CKLM Inverted region с D What would be the outcome of alternate segregation, adjacent -1 segregation and adjacent-2 segregation? 5. Two phenotypically unaffected parents produce two children with familial Down syndrome. Regarding chromosome 14 and 21, what are the chromosomal composition of the parents? 6. Explain how aneuploidy, deletions and duplications cause genetic imbalances. 7. Why do you think that deletions and monosomies are more detrimental than duplications and trisomies? 8. Describe some of the advantages of polyploid plants. 9.…