Experiment: DNA Extraction from Banana The procedures are attached below. Questions: 1. What does mashing do to the fruit? And why is it needed to add detergents? 2. What do you think the ethanol does? Why can’t we use room temperature ethanol?
Q: ATP is a source of free energy that drives unfavorable reactions. Which of the processes are coupled…
A: The free energy changes in chemical reactions are denoted by ΔG. ∆G = ∆H − T∆S where ∆H is the…
Q: The disease phenylketonuria is characterized by increased nervousness and fidgeting. elevated levels…
A: Amino acids can be degraded & certain amino acid can be interconverted to another amino acid…
Q: As Build's laboratory partner, help him determine the following: 1. maximum amount of the unknown…
A: Gel filtration chromatography is a type of chromatography in which proteins are separated based on…
Q: Draw the electron pushing mechanism
A: Electron pushing mechanism shows the jumping of electrons in the substrate and/or reaction…
Q: true/ false: When proteins are denatured 1°, 2°, 3°, and 4° structure is lost.
A: Denaturation is a process in which proteins lose their original structure or confirmation. The loss…
Q: When muscle is at rest, creatine phosphate is produced from ATP in order to store energy. What is…
A: Most of the time, certain cellular reactions are highly endergonic reaction, that is they are…
Q: Calculate the volumes of the 100 mM PNPP stock solution and buffer (final volume of 1.00 ml) needed…
A: Molarity is way of representing the concentration of a solution. Molarity is the number of moles of…
Q: Fatty acids and triglycerides are an important source of nutrition and a dense form of stored…
A: Carbohydrates are the primary source of energy. But in the absence of carbohydrates, the body…
Q: Finally, using the formula to convert between standard states, show that that your calculated values…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: In the following structure, the carbon labeled [Select] carbon, the carbon labeled [Select] is…
A: Monosaccharides are the simplest units of sugars. All monosaccharides are either aldoses or ketoses.…
Q: 2. Complete the following for serine, tyrosine, and gylcine. a. Draw the amino acid. b. Circle the…
A: Amino acids are the building blocks of proteins. they can be classified into different groups based…
Q: The structure of a metalloenzyme active site is down below(black picture). Describe, from a chemical…
A: Methane monooxygenase (MMO) is present in methanotrophic bacteria and MMO is present in an integral…
Q: A gerbil is fed a normal diet including 14C-lysine. After a period of time on this diet biopsies are…
A: Gerbils are mammals , so only mammalian metabolism can be used here. In the figure below showing the…
Q: Name three ketone bodies and describe their functions
A: Ketogenesis is a process by which the liver produces ketone bodies from fatty acids, as a source of…
Q: Given: Beer-Lambert Law A = Ecl E = 8000 for Met myoglobin E= 14,000 for oxy-myoglobin l=1 cm…
A: According to Beer-Lambert law the concentration of the sample is directly proportional to the…
Q: Pathological Constituents of Urine Fill in the table below for your observations Pathological…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: What are the biochemical cycles?
A: Biochemistry is the way of understanding of different chemical reactions that occur within the…
Q: Which symptom is the best indication of Lesch-Nyhan disease in a patient? Chronic lysis of red blood…
A: Lesch-Nyhan disease is a rare genetic syndrome caused due to hypoxanthine-guanine phosphoribosyl…
Q: I have built an urn model for a DNA sequence. I have taken the letters from a sequence 1946…
A: DNA is composed of sequence of nucleotides (adenine, thymine, guanine and cytosine) linked by 3-5…
Q: 18:249, 12 refers to a fatty acid that contains: 18 carbons, 2 double bonds, and saturation at…
A: Fatty acids are the simplest type of lipids. They are carboxylic acids with hydrocarbon chain. They…
Q: The PDH complex is a logical point of regulation in metabolism, as it links two major catabolic…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: (a) Estimate the Km and Vmax for the wild-type and mutant enzyme from the graph. (b) Calculate the…
A: For a one-substrate enzyme catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: What is the actual change in free energy at 37°C for the phosphoglycerate mutase reaction converting…
A: Phosphoglycerate Mutase: Phosphoglycerate Mutase is an enzyme involved in the glycolytic process.…
Q: 17-21 Is the rea (PEP) a re
A: Glycolysis is the process of breaking down glucose into two pyruvate molecules results in the…
Q: When a product inhibits an enzyme by binding to the active site, which of the following would occur?…
A: Introduction Enzymes are known as biocatalyst. They increases rate of a chemical reaction by…
Q: Elongation of fatty acids chains beyond 16 carbons takes place: on the membrane of the endoplasmic…
A: Acetyl CoA from glucose oxidation or other anaplerotic reactions is produced in mitochondria and…
Q: When looking at a double helix what are the names of the different grouves?
A: Double helix is a structure in which two helical structures are wind over each other. For examples,…
Q: How can an unfavorable reaction (AG°¹ > 0) still occur in a metabolic pathway? By increasing the…
A: Metabolic reactions are the biochemical reactions that are essential for our cells to get energy…
Q: Identify what is asked Glycerol --> Glycogen Pyruvate --> Glucose Acetyl CoA --> Fats Fats-> Acetyl…
A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…
Q: Tay-Sachs disease is result from a)malfunction of cerebroside metabolism b)the accumulation of GM2…
A: Tay Sachs disease is a recessively inherited genetic disease. It is characterised by the destruction…
Q: [Select] [Select] [Select] transport. V transport. would move across a membrane using simple…
A: The biological membrane that surrounds a living cell is called the cell membrane. The structure of…
Q: The following is a(n) [Select] [Select] V [Select] disaccharide with a(n) glycosidic bond.
A: Disaccharides are sugars which are formed as a glycosidic bond is formed between 2 monosaccharides.…
Q: -11- E + SF k_1 ES ₂ E + P k2 › 10.0 + S ↓↑K IS ESS st Based on this model, please answer the…
A: The cessation of enzymatic activity is generally known as enzyme inhibition. It is generally of two…
Q: Select ALL statements that are true about the isoelectric point (pI) of a protein a.Protein carries…
A: The isoelectric point (pI) of a protein is the pH at which the protein is neutral or the overall…
Q: In active muscle cells, the pO2 is about 10 torr at the cell surface and 1 torr at the mitochondria…
A: Fractional saturation (Y) is the fraction of protein that is ligand bound. Y= moles of…
Q: (a) 2,3-Bisphosphoglycerate (BPG) reduces binding of O₂ to hemoglobin from almost hyperbolic to…
A: Hb is a protein responsible for carrying both O2 and CO2 in blood. 1 Hb protein is composed of 4…
Q: what are correct about enzyme kinetic parameters
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They contain an…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q: Phosphoenolpyruvate (PEP) is converted to pyruvate by the enzyme pyruvate kinase. The standard free…
A: The standard free energy change (∆Gº') is the amount of energy released in of biochemical reaction…
Q: Please answer the following two questions: 1. Biochemistry and function of chylomicrons 2. The…
A: Chylomicrons are lipoproteins synthesized in the intestine. Lipoproteins are compound lipids…
Q: RESULTS Table 1. Absorbance values of BSA standards. ● ● Test Tube No. BSA (μL) DDW (μL) 100 80 60…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: a) Describe the three irreversible reactions of the Citric Acid Cycle. Ensure to indicate their…
A: Krebs cycle or tricarboxylic acid (TCA) cycle in aerobic organisms is the final stage of catabolism…
Q: A pentapeptide has the abbreviation "GREAT". Draw the peptide and give its systematic name.
A: Peptides are short sequences of amino acids. Amino acids in a peptide are joined together through…
Q: *Complete hydrolysis of glycerophospholipid yields equimolar amounts of glycerol, a fatty acid [16:1…
A: Lipids are classified into three groups as simple lipids, compound lipids, and derived lipids based…
Q: Which of the following is considered an omega-6 fatty acid?
A: Since animals cannot synthesize omega-6 and omega-3 fatty acids, they must be obtained from their…
Q: Elaidic acid is an 18 carbon fatty acid with a trans double bond at carbon 9 that is produced in…
A: The major physical property of fatty acid is their melting point, which in-turn define at which…
Q: What percentage of molecules of peptide GGGG has no ionized groups (e.g. has BOTH protonated…
A: Amino acids: An amino acid can function as both an acid and a base because of its structural…
Q: What is the overall net reaction of glycolysis? C6H12O6 + 2 NADH + 2 P₁ + 2 ATP --> 2 C3H3O3 + 2…
A: In glycolysis, glucose is oxidized into pyruvate. It involves a series of enzyme-catalyzed…
Q: true/false: Humans produce isoleucine using pyruvate as a starting material.
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Citrate synthase is inhibited by: NAD+ ADP NADH oxleoacetate All of the above None of the above
A: Explanation Glycolysis is a process by which glucose breaks into pyruvate and gives energy in the…
Experiment: DNA Extraction from Banana
The procedures are attached below.
Questions:
1. What does mashing do to the fruit? And why is it needed to add detergents?
2. What do you think the ethanol does? Why can’t we use room temperature ethanol?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- sampies B. In this picture of gel electrophoresis of DNA, which sample contains the longest/largest piece of DNA? O A. A O B. BDNA Extraction by Alkaline Lysis Procedure: 1. Spin 1.5 ml of cells in a microcentrifuge at maximum speed (12,000 rpm) for 20s to pellet. Remove the supernatant completely with a Pasteur pipet or a plastic pipettor tip. The spins can be performed at 4C or at room temperature. Longer spins make it difficult to resuspend cells. 2. Resuspend pellet in 100µl GTE solution and let sit 5 min at room temperature. Be sure cells are completely resuspended. 3. Add 200µl NaOH/SDS solution, mix by tapping tube with finger, and place on ice for 5 min. 4. Add 150µl potassium acetate solution and vortex at maximum speed for 2s to mix. Place on ice for 5-15 min. Be sure mixing is complete. 5. Spin 3 min at 12,000 rpm to pellet cell debris and chromosomal DNA. 6. Transfer 0.4 ml supernatant to a fresh tube, mix it with 0.8 ml of 95% ethanol or 0.4 ml isopropanol, and let sit 2 min at room temperature precipitate nucleic acids. 7. Spin at 12,000rpm for 3 min at room temperature to pellet plasmid DNA and…n gel electrophoresis of DNA, the different bands in the final gel form because the DNA molecules _______. a. are from different organisms b. have different lengths c. have different nucleotide compositions d. have different genes
- Indicate true or false for the following statements The glycerol used in the DNA loading dye allows DNA to be visualized under UV light. The DNA Ladder used for agarose gel electrophores can be used to estimate fragment size and DNA concentration. During gel electrophoresis a DNA smear may indicate that DNase was still present in the sample.DNA Extraction by Alkaline Lysis Procedure: 1. Spin 1.5 ml of cells in a microcentrifuge at maximum speed (12,000 rpm) for 20s to pellet. Remove the supernatant completely with a Pasteur pipet or a plastic pipettor tip. The spins can be performed at FC or at room temperature. Longer spins make it difficult to resuspend cells. 2 Resuspend pellet in 100pul GTE solution and let sit 5 min at room temperature. Be sure cells are completely resuspended. 3. Add 200ul NaOH/SDS solution, mix by tapping tube with finger, and place on ice for 5 min. 4. Add 150ul potassium acetate solution and vortex at maximum speed for 2s to mix. Place on ice for 5-15 min. Be sure mixing is complete. 5. Spin 3 min at 12,000 rpm to pellet cell debris and chromosomal DNA 6. Transfer 0.4 ml supernatant to a fresh tube, mix it with 0.8 ml of 95% ethanol or 0.4 ml isopropanol, and let sit 2 min at room temperature precipitate nucleic acids. 7. Spin at 12,000rpm for 3 min at room temperature to pellet plasmid DNA and…1.00 Oc. Lyse the cells to release the nucleic acid P Flag O d. Break up the DNA question O e. Precipitate the DNA Question 3. The picture below shows the last step of nucleic acid extraction after the centrifugation step, the layer labelled A contains.. Not yet answered Marked out of 1.00 P Flag question Answer: Question In the experiment of amylase extraction from barely seeds, after the second centrifugation- the amylase enzyme will be found in
- Writing a Full Strand:1. A. Original DNA: CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT Complementary DNA:_______________________________________________________________________ B. Make identical strands of DNA CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT (original) ______________________________________________________________________ (new) _____________________________________________________________________ (new) ______________________________________________________________________ (complementary from 1A)2. A. Original DNA: CCG GAT TTT AAT TAG CTA CTA TCG TAC TAC GTT GGT GCT Complementary DNA: _______________________________________________________________________ B. Make identical strands of DNA CCG GAT TTT AAT TAG CTA CTA TCG TAC TAC GTT GGT GCT (original) _______________________________________________________________________ (new) ________________________________________________________________________ (new)…. I 1 I 2 I 3. I 4. I 5. L . Question 1 DNA TEMPLATE: 3 'GCA TTT GAT AAA TAC CTG AGA TGA CTG ATT GGG GGC AAA 5' 5' CGT AAA CTA TIT ATG GAC TCT ACG GAC TAA CCC CCG TTT 3' 1. Synthesize a piece of DNA to complement the template: 2. Using the given DNA template synthesize the MRNA: 3. What is the amino acid sequence of this protein? Good to go O Focus(ACADEMIC) Time The solid matrix that is usually used to attach the target DNA in southern blotting technique is usually a O a. Polyacrylamide gel O b. Petri dish Oc. Cell culture plate O d. Membrane Oe. Micro-titer plate CLEAR MY CHOICE
- Results obtained from a Nano Spec. DNA samples collected: ng/uL A260/A80 A260/A230 E.coli genomic DNA 45.3 1.68 0.84 pEMBL1.9 26.0 1.80 1.09 pBluescript 82.1 1.90 1.89 What does this results tell us about the purity of the DNA samples? What are possible contaminations that may have occured?Which of the following conditions will affect the specificity of primer annealing? You may choose more than one answer. Annealing temperature Denaturation temperature Polymerization time _ [MgCl2]Samples/Enzyme DNA fragment(s) length 1. None 1500 2. ECORI 700, 800 3. BamHI 300, 1200 4. EcoRI and BamHI 300, 500, 700 А. Using the line below, draw a map showing the locations for each enzyme digestion site. Include distances. _1500 Use paper and draw more lines and try different combinations of cuts until you get the fragments with the right dimensions. Remember that I am asking to have resulting fragments long 300, 500 and 700 bps but they DO NOT have to be in that order.