Below are 9 possible primer pairs. ● Determine which primer pair is the best choice. ● Explain why the other primers are not good choices. ● Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best. Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm = Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm = Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm = Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm = Forward 3: 5’ agattagcggatcctacctg 3’ Tm = Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm = Forward 4: 5’ cattgattatttgcacggcg 3’ Tm = Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm = Forward 5: 5’ tccataagattagcggatcc 3’ Tm = Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm = Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm= Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm = Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm = Reverse 7: 5’aggtcgactctagaggatc 3’ Tm = Forward 8: 5’ctacctgttccatggccaac 3’ Tm= Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm= Forward 9: 5’ tccataagattagcggatcc 3’ Tm = Reverse 9: 5’ tctcgcatgggggaccccac 3’ Tm = Answer: 1. Best primer pair choice: 2. Why are the rest not good choices?
Below are 9 possible primer pairs.
● Determine which primer pair is the best choice.
● Explain why the other primers are not good choices.
● Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best.
Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm =
Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm =
Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm =
Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm =
Forward 3: 5’ agattagcggatcctacctg 3’ Tm =
Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm =
Forward 4: 5’ cattgattatttgcacggcg 3’ Tm =
Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm =
Forward 5: 5’ tccataagattagcggatcc 3’ Tm =
Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm =
Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm=
Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm =
Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm =
Reverse 7: 5’aggtcgactctagaggatc 3’ Tm =
Forward 8: 5’ctacctgttccatggccaac 3’ Tm=
Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm=
Forward 9: 5’ tccataagattagcggatcc 3’ Tm =
Reverse 9: 5’ tctcgcatgggggaccccac 3’ Tm =
Answer:
1. Best primer pair choice:
2. Why are the rest not good choices?
Step by step
Solved in 2 steps
