Below are 9 possible primer pairs. Determine which primer pair is the best choice by considering the following: 1. primers should be 18-24 bases in length; 2. base composition should be 45-55% (G+C); 3. primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming; 4. Tms between 55-70°C are preferred (Tas, annealing temperatures, are approximately 5°C lower than the Tm); 5. the Tm for your primer pair should be within 2 degrees of each other, though ideally the same; 6. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided; 7. 3'-ends of primers should not be complementary (i.e. base pair), as otherwise the formation of primer dimers will result; 8. primer self-complementary (ability to form secondary structures such as hairpins) should be avoided. • Explain why the other primers are not good choices. Underline or highlight the region of DNA for the primer pair you chose as the best. Forward 1: Reverse 1: Forward 2: Reverse 2: Forward 3: Reverse 3: Forward 4: Reverse 4: Forward 5: Reverse 5: Forward 6: Reverse 6: Forward 7: Reverse 7: Forward 8: Reverse 8: Forward 9: Reverse 9: Answer: 5' gaaataattttgtttaactttaag 3' 5' gtttaagacaaaatagtctgg 3' 5' gtaactcagetttcaggtcg 3' 5' tctcggaatgttgcaacage 3' 5' agattagcggatcctacctg 3' 5' atgtgtaatcccagcagcag 3' 5' cattgattatttgcacggcg 3' 5' aaaatcttctctcatccgcc 3' 5' tccataagattagcggatcc 3' 5' tgcaagettggctgttttgg 3' 5' gatectacctgacgcttttta 3' 5' aaataatgaattegagetcggt 3' 5'ataaaaaaategagataaccgtt 3' 5'aggtcgactctagaggate 3' 5'ctacctgttccatggccaac 3' 5' ttcgggcatggcactcttg 3' 5' tccataagattagcggatec 3' 5' tctcgcatgggggaccccac 1. Best primer pair choice: 2. Why are the rest not good choices? Tm = 56°C Tm = 56°C Tm= 60°C Tm= 60°C Tm= 60°C Tm = 60°C Tm = 58°C Tm= 58°C Tm = 58°C Tm= 60°C Tm= 60°C Tm = 60°C Tm = 58°C Tm= 58°C Tm= 62°C Tm= 60°C Tm = 58°C Tm = 68°C

Below are 9 possible primer pairs. Determine which primer pair is the best choice by considering the following: 1. primers should be 18-24 bases in length; 2. base composition should be 45-55% (G+C); 3. primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming; 4. Tms between 55-70°C are preferred (Tas, annealing temperatures, are approximately 5°C lower than the Tm); 5. the Tm for your primer pair should be within 2 degrees of each other, though ideally the same; 6. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided; 7. 3'-ends of primers should not be complementary (i.e. base pair), as otherwise the formation of primer dimers will result; 8. primer self-complementary (ability to form secondary structures such as hairpins) should be avoided. • Explain why the other primers are not good choices. Underline or highlight the region of DNA for the primer pair you chose as the best. Forward 1: Reverse 1: Forward 2: Reverse 2: Forward 3: Reverse 3: Forward 4: Reverse 4: Forward 5: Reverse 5: Forward 6: Reverse 6: Forward 7: Reverse 7: Forward 8: Reverse 8: Forward 9: Reverse 9: Answer: 5' gaaataattttgtttaactttaag 3' 5' gtttaagacaaaatagtctgg 3' 5' gtaactcagetttcaggtcg 3' 5' tctcggaatgttgcaacage 3' 5' agattagcggatcctacctg 3' 5' atgtgtaatcccagcagcag 3' 5' cattgattatttgcacggcg 3' 5' aaaatcttctctcatccgcc 3' 5' tccataagattagcggatcc 3' 5' tgcaagettggctgttttgg 3' 5' gatectacctgacgcttttta 3' 5' aaataatgaattegagetcggt 3' 5'ataaaaaaategagataaccgtt 3' 5'aggtcgactctagaggate 3' 5'ctacctgttccatggccaac 3' 5' ttcgggcatggcactcttg 3' 5' tccataagattagcggatec 3' 5' tctcgcatgggggaccccac 1. Best primer pair choice: 2. Why are the rest not good choices? Tm = 56°C Tm = 56°C Tm= 60°C Tm= 60°C Tm= 60°C Tm = 60°C Tm = 58°C Tm= 58°C Tm = 58°C Tm= 60°C Tm= 60°C Tm = 60°C Tm = 58°C Tm= 58°C Tm= 62°C Tm= 60°C Tm = 58°C Tm = 68°C

Basic Clinical Laboratory Techniques 6E

6th Edition

ISBN:9781133893943

Author:ESTRIDGE

Publisher:ESTRIDGE

Chapter3: Basic Hemostasis

Section3.6: D-dimers

Problem 8RQ

See similar textbooks