Assume that a file containing a series of integers is named numbers.txt . Write a program that calculates the average of all the numbers stored in the file and prints the average to the screen. Sample Run 49.6
Q: In JavaFX I need to create a standard calculator with two input fields and one output field that can…
A: According to the information given:- We have to create Standard calculator with two input fields and…
Q: Calculate the delay x bandwidth product for the following links. Use one-way delay, measured from…
A:
Q: Calculate the effective bandwidth for the following cases. For (a) and (b) assume there is a steady…
A:
Q: Suppose we want to transmit the message 1011 0010 0100 1011 and protect it from errors using the…
A:
Q: One of the benefits of a honey pot is that it affords a person the opportunity to commit crimes…
A: The above question is solved in step 2 :-
Q: - Suppose that we attempt to run the sliding window algorithm with SWS = RWS = 3 and with MaxSeqNum…
A:
Q: Suppose that these two statements were sequentially appearing within your Rectangle program’s main()…
A: Not valid statementAs we did not create the object for class Rectangle, Just we have created the…
Q: 3.Write 4 examples for Web applications.
A: Introduction The following are the four examples of Web applications:- 1. Some websites like sports…
Q: have learned from the class "history of computing.
A: The history of computing is longer than the history of computing hardware and modern computing…
Q: write a program in c++ that contains declares a student_t data structure and defines functions to:*…
A: write a program in c++ that contains declares a student_t data structure and defines functions to: *…
Q: What does the 'and' Boolean operator do? a. It compares two conditions. Only if both are True is the…
A: Dear Student, "and" boolean operator compares two conditions separated by "and" , also result is…
Q: nd the smallest Max ] is in the receive wi e. nowing that MaxSec
A: 1) The smallest working value for MaxSeqNum is 8 It suffices to show that if DATA[8] is in the…
Q: A micro instruction format has micro operation field which is divided into 2 subfields F1 and F2,…
A: As given - A micro instruction format has micro-operationthe field which is divided into 2 subfields…
Q: d (b) assume there is a s ply calculate the averag 0-Mbps Ethernet throu- ritches as in Exorciso 16
A: (a) The effective bandwidth is 100 Mbps, so that the sender can send data steadily at this rate and…
Q: Given the following undirected unweighted graph G(V, E). a C What is E? b d e
A: A graph is an ordered pair (V, E), where V is called the vertex set and E is called the edge set. An…
Q: Construct a Binary tree using following information Inorder sequence - 1,2,3,4,5,6,7,8 Pre-order…
A: The tree in which every parent node has at most two child nodes is known as a Binary tree.
Q: 3. Write the function to evaluate/compute the following, i.e. the value of Pl given by the…
A: The above question is solved in step 2 :-
Q: Multiple answer: Which statements will correctly flip (invert) bits 6 and 7 of an integer x x =…
A:
Q: In C program. implement list_find( list_t* list, int targetElement ) function /* * dataStructure.h *…
A: The answer is given below.
Q: What is Onion network?
A: Onion network or in other words we can say that is short form of TOR ( The Onion Routing ) is an…
Q: non-volatile da inning Windows
A: Volatile data: Volatile data is the data that is typically put away in reserve memory or RAM. This…
Q: - Consider an ARQ protocol that uses only negative acknowledgments (NAKS), but no positive…
A:
Q: (c) Explain why waterfall architecture is suitable for ResApp. Provide ONE (1) justification. (d)…
A: The above question is solved in step 2 :-
Q: es between nodes in an eight-node network is presented in the from-to distance table below. What is…
A: Here, from the question In the given problem, the graph contains 8 nodes from 1 to 8 in it..…
Q: #function read file and display report def displayAverage(fileName): #open the file infile =…
A: I have provided PYTHON CODE, CODE SCREENSHOT , TXT FILE SCREENSHOT and OUTPUT…
Q: Suppose that we run the sliding window algorithm with SWS = 5 and RWS = 3, and no out-of-order…
A: Introduction Two normal settings are: RWS = 1 , which infers that the beneficiary won't support…
Q: In the expression, what is the range of values assigned to n? n = -15 + rand() % 23; O [-15, 23] O…
A: Here we have a code written in C++ programing language. Next, we have used the rand() function to…
Q: Instructions: Review the OSINT Resource Tools List Task: Write a 2-3 page paper reviewing 10-15…
A: OSINT refer to a collection of data from public sources to be used in an intelligence…
Q: who have cars of type ‘Premium’ (v) Show the cities and the number of drivers, where at least 1000…
A: Given : (iv) Retrieve the names and cities of all drivers who have cars of type ‘Premium’
Q: How can forensic investigators extract volatile and non-volatile data from PCs running Windows?
A: According to the question both are used for makes secure the data at the organization in which they…
Q: short answer please compare and contrast the definition of a project versus a program
A: The answer for the above question is given in the below steps
Q: 2. The Optimal Order paper company has received orders for four different groups of publications.…
A: Answer:-
Q: Given the following undirected unweighted graph G(V, E). a C What is E? b d e
A: The given graph is G ( V , E ) where , V represent the set of all vertices which is present in a…
Q: what is variac? disadvantages please
A: We need to discuss variac and its disadvantages.
Q: 5. (Algebra: solve 2 x 2 linear equations) You can use Cramer's rule to solve the following 2 X 2…
A: Input the numbers from the user, split the number and convert them into float. unzip the list item…
Q: statuses for all registered children that is emailed to the staff and authorities concerned. They…
A: Solution: The SDLC should not be scrapped for every project because some systems may be prematurely…
Q: How does Python know which code needs to be executed on the false path of an if/else statement? a.…
A: Dear Student, When a condition is true the if part of the if/else statement is executed where as…
Q: Suppose that we run the sliding window algorithm with SWS = 5 and RWS = 3, and no out-of-order…
A: The question is related to sliding window protocol.
Q: Digital ele, computer science!.
A: given : F(W,X,Y,Z)=(Y'+X)(W+X)
Q: Consider a simple protocol for transferring files over a link. After some initial negotiation, A…
A: Stop-and-wait Stop-and-wait ARQ likewise alluded to as rotating bit convention, is a strategy in…
Q: 1.Accept a command line argument which is the purchase data file in the following format: Here is an…
A: Algorithm: Initialize all the required header files.Save the given data into some file let us…
Q: Please provide me a C program that prints the message "C Programming." in the output 10 times using…
A: Approach: The goto keyword is used in the program where we create labels in the program and the goto…
Q: Your task is to create a program that prompts the user with the following user menu: Please enter…
A: The above question is solved in step 2 and step 3 :-
Q: There are blank 3 digit counting numbers that are made using only the odd digits 1,3,5,7,9 ?
A: To form a 3 digit number using 1,3,5,7,9. We know that all the 3 digit places are must be one of the…
Q: Design the wireframes and storyboard, interactivity diagram, object dictionary, and any necessary…
A: The storyboard/wireframe, interactivity board, object dictionary, and code are given below
Q: Calculate the total time required to transfer a 1.5-MB file in the following cases, assuming an RTT…
A:
Q: Most common media player VLC stands for video client.
A: To be determine: Fill the blank
Q: C++ 1.Accept a command line argument which is the purchase data file in the following format: Here…
A: Initialize all the required header files. Save the given data into some file let us transaction.txt.…
Q: 17824 bits of data is to be transferred from a station A to station B. Assume a call setup time of…
A: According to the information given:- We have to follow the instruction in order to find out the…
Q: TASK 1 1. Enter a vector X which consists of points (0, 0.1, 0.2, 0.3,.., 5). 2. Create the row…
A: Since no programming language is mentioned, I am using Matlab. Code: format shortG % 1X=0:0.1:5 %…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- PYTHON!!!!! A file concordance tracks the unique words in a file and their frequencies. Write a program that displays a concordance for a file. The program should output the unique words and their frequencies in alphabetical order. Variations are to track sequences of two words and their frequencies, or n words and their frequencies. Below is an example file along with the program input and output: example.txt I AM SAM I AM SAM SAM I AM Enter the input file name: example.txt AM 3 I 3 SAM 3 The program should handle input files of varying length (lines). Program produces correct output given input, test 1 Test Case: Test program with example.txt Input: example.txt Results: AM 3 I 3 SAM 3 Program produces correct output given input, test 2 Test Case: Test program with test file 2 Input: test.txt Results: 3/4 1 98 1 AND 2 GUARANTEED 1 INDEED 1 PERCENT 1 SUCCEED 1 WILL 2 YES 1 YOU 2wordSort.py: Write a program that reads words from a file (filename given as a command-line argument) and prints them in (case insensitive) sorted order. For example, if the input file contains:If there's a problem yo I'll solve itCheck out the hook while my DJ revolves itIce ice baby The program should print (one word per line, compressed here for brevity):a baby Check DJ hook I'll Ice ice If it it my outproblem revolves solve the there's while yowordCountDistinct.py: Write a program that reads words from a file (filename given as a command-line argument) and prints the number of distinct words. Words that differ only in case should be considered to be equivalent.For example, using the input: If there's a problem yo I'll solve itCheck out the hook while my DJ revolves itIce ice baby The program should print 18.
- The function print_last_line in python takes one parameter, fname, the name of a text file. The function should open the file for reading, read the lines of the file until it reaches the end, print out the last line in the file, report the number of lines contained in the file, and close the file. Hint: Use a for loop to iterate over the lines and accumulate the count. For example: Test Result print_last_line("wordlist1.txt") maudlin The file has 5 lines.OWrite a program that reads data from a file containing integers that ends with -999. Output the numbers that are divisible by 7 Output the numbers that are divisible by 11 Output the numbers that are not divisible by 7 or 11.num.txt is a file that contains a list of scores. num.txt 10 25 36 45 89 42 54 create a program that reads the scores from num.txt file one line at a time. The program should display their total and average. since the number of scores is unknown, the program must keep looping until readline is blank. Sample Output: There are 7 scores The total is 301 T he average is 43.0
- The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcompositionUse pythonThe file "dna.seq" (on Blackboard) consists of several DNA sequences. Write a program that reads in the file "dna.seq” and counts the number of sequences with the following properties: • The total number of sequences in the file • The number of sequences that have the pattern CTATA • The number of sequences that have more than 1000 bases • The number of sequences that have over 50% GC composition • The number of sequences that have more than 2000 bases and more than 50% GC composition Some program requirements: (1) the program should prompt the user for the filename. (2) each of the above tasks should be its own function. dna seg file = CAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTATACCGCGAAACTGCGAATGGOTCATTAAATCACT TATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGOTAATACATGOTAAAAAGO CCGACTCACGGAGGGTTGTATTTATTAGATTAAAAAThe file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcomposition
- JAVA PPROGRAM Write a program that prompts the user to enter a file name, then opens the file in text mode and reads names. The file contains one name on each line. The program then compares each name with the name that is at the end of the file in a symmetrical position. For example if the file contains 10 names, the name #1 is compared with name #10, name #2 is compared with name #9, and so on. If you find matches you should print the name and the line numbers where the match was found. While entering the file name, the program should allow the user to type quit to exit the program. If the file with a given name does not exist, then display a message and allow the user to re-enter the file name. The file may contain up to 100 names. You can use an array or ArrayList object of your choosing, however you can only have one array or ArrayList. Input validation: a) If the file does not exist, then you should display a message "File 'somefile.txt' is not found." and allow the…1. Write a java program that asks the user for a positive nonzero integer value. The program should use a loop to get the sum of all the integers from 1 up to the number entered. For example, if the user enters 50, the loop will find the sum of 1, 2, 3, 4, . . . 50. Filename: SumLoop.javaCode should be in Python. A photographer is organizing a photo collection about the national parks in the US and would like to annotate the information about each of the photos into a separate set of files. Write a program that reads the name of a text file containing a list of photo file names. The program then reads the photo file names from the text file, replaces the "_photo.jpg" portion of the file names with "_info.txt", and outputs the modified file names. Assume the unchanged portion of the photo file names contains only letters and numbers, and the text file stores one photo file name per line. If the text file is empty, the program produces no output. (Examples in image)