Q: Several students in our class always sit together in the front row. Suppose this could be because…
A: Plasma membrane is made up of lipid bilayer which is hydrophobic in Nature. In eukaryotes mostly…
Q: Compare the appearance of the "e" when viewed with the naked eye to its appearance when viewed under…
A: Introduction: - Microscopes are optical devices used to magnify an object. They are commonly used in…
Q: Which of the following would be a good example of a microclimate? The cool humid air that escapes…
A: Ans: Microclimates are described as the climate within a small area that differs from the climate of…
Q: c. Describe how the Honey Eater and Callistemon depend on each other for survival by explaining…
A: Although honey-eaters range in size from extremely large (Wattlebirds, 40 cm or more, and…
Q: Question 10 What is NOT true of the structure of RNA? It is sometimes single-stranded It is less…
A: Introduction: Ribonucleic acid is referred to as RNA. It is a nucleic acid that is crucial for…
Q: II. ILLUSTRATIONS. For each of the given proteins: Draw the final location of the following proteins…
A: Introduction:- I submit the answer in a picture form so students understand easily . Bacause…
Q: Caleb has a double row of eyelashes, which he inherited from his mother as a dominant trait. His…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: What is the purpose of cellular respiration? What is the purpose of photosynthesis?
A: Respiration is process by which energy (ATP) is produced from food substances inside the living…
Q: H9 IMR90 DMRS Gene Chr10 T JA a. Name one method that could have been used to determine where the…
A: It is an example of the distributions of DNA methylation levels and differentially-methylated…
Q: Girdling is a process by which
A: Girdling refers to the complete removal of bark. The xylem and phloem are two circulatory tissues…
Q: Which of the following is NOT found in heterochromatin? O A. Centromeres OB. Most of the Y…
A: Introduction Heterochromatin, often known as condensed DNA or densely packed DNA, has several…
Q: Question: Which of the following has NOT occurred as commercial fishing has expanded? A Fishers (men…
A: Commercial fishing is the practice of taking fish, in whole or in part, for the purpose of trading,…
Q: In detail explain how C3 plant leaf is different from C4 plant leaf and why, use you overall…
A: C3 plants are those that use the C3 carbon fixation pathway, and the first product of carbon dioxide…
Q: Are Hydra considered a microorganism? explain.
A: The living organisms are classified according to their characteristics. Based on the different…
Q: How can a drug influence the immune system? In your answer also include an example for each…
A: Immune system consists of various immune cells and various types of immunity against the outside…
Q: Assuming mitosis is divided into prophase, prometaphase, metaphase, anaphase, and telophase,…
A: Mitosis is a type of cell division resulting in the formation of two daughter cells that are similar…
Q: 3. Despite your chaotic nature, you various types of RNA species (molecules) following their…
A: rRNA is a ribonuclic achid which is synthesized inside the nucleus of the cell.
Q: Identify the component parts of the plasma membrane shown in Figure 1. side cell
A: Plasma membrane is the external boundary of the cell that protects the cell from the exterior…
Q: What is a species
A: Speciation is the process by which daughter species evolve from a parent species. There are…
Q: 1)How inflammation of the irritated airway would restrict airflow? 2)Explain how smooth muscle spasm…
A: Inflammation is defined as a process of fighting with infections by our immune system to heal injury…
Q: RESPIRATION 1. What is the purpose of cellular respiration? . Where is cellular respiration…
A: Respiration is the process where oxygen move from outside environment to the cell within tissues and…
Q: 100 words brefily explain the orgin and evolution of reptiles
A: Reptiles descended from Carboniferous-era amphibians. They created a huge, shelled egg with a lot of…
Q: Natural selection works on a. individuals. b. genes. c. populations. d. species.
A: Introduction :- The process through which populations of living things adapt and change is known as…
Q: Sort the following photos into three taxa (groups). Each taxa must contain only four creatures - no…
A: Introduction A taxon is a collection of one or more populations of an organism or populations of…
Q: what are the limitations of spectrometry when testing living things?
A: The availability of application oriented and user friendly system including specific tools for easy…
Q: Identify the most cost effective enzyme purification method and provide brief explanations for this…
A: Enzymes need to be purified from cell extract to remove the undesired compounds which helps to…
Q: What are the compounds in bioplastic and how to induce the production of bioplastic from bacteria?…
A: Bioplastics: Biodegradable materials that come from renewable sources and can help eliminate the…
Q: QUESTION 2 Ability of the test to correctly identify those with the disease is defined as its: A.…
A: Introduction :- Disease is any adverse variation from an organism's normal structural or functional…
Q: The post-translational OA. is performed by OB. is removed by phosphatases. OC. can activate or in…
A: Translating a code simply involves changing it from genetic code to proteins. The initiation and…
Q: What kind of method of preparation was done? method of preparation (e.g. decoction, infusion,…
A: Given information The extracts are taken from the leaf and stem of M. quadrifolia and soaked in…
Q: 10. In a garden pea, yellow cotyledon color is dominant to green and inflated pod shape is dominant…
A: In scientific analysis or the validation of a hypothesis we usually perform chi-square (x2)…
Q: How do I make a Calibration plot with this?
A: Graphs or plots are generally used to organize the data. It also helps to tell the relationship…
Q: Would anyone be able to explain these different channels? I would like an explanation as to why…
A: All ion channels are primarily located at their respective sites depending on their response to that…
Q: Beaches are monitored to protect public health. Waterborne pathogens can cause illnesses. Which of…
A: Introduction Microbes are extremely minute living entities that are all around us and are invisible…
Q: The table shows where different restriction endonucleases (restriction enzymes) cleave DNA. The…
A: Restriction enzymes identify and cut DNA at specific nucleotide sequences. A restriction site is a…
Q: Biology Question
A:
Q: The flowers of 40 ′′ clock plants may be red, pink or white. Reds crossed to whites produced only…
A: The Chi-Square Test is one of the most frequently used statistical tests (X 2 Test). In this test,…
Q: Positive Predictive Value (PPV) is defined as: OA. Probability that people who test positive are…
A: Diagnostic tests are the procedures used to identify the presence/ absence, cause, or progress of an…
Q: Name the four genera of Enterobacteriaceae that can cause gastrointestinal disease. Which two can…
A: Standard DisclaimersSince you have posted or the asked the multiple question, we have will solve…
Q: Describe cells of the Epidermis ?
A: Skin is a large organ which acts as a barrier between outside and inside environment. It protects us…
Q: What is the evolutionary advantage of bacteria that have flagella vs. bacteria that do not?
A: Flagella is a hair-like structure found in many microorganisms (including bacteria) that allows them…
Q: You are growing tomatoes and your plants are healthy and nearly one metre tall. You worry that they…
A:
Q: why alcoholic fermentation is not the most efficient process for producing ATP?
A: The product of glycolysis is pyruvate.In the absence of oxygen,the pyruvate undegoes processes like…
Q: 1. In the 1950s, many scientists thought that proteins, not DNA, carried genetic information. a. Why…
A: Note:- Sorry, as per the honor code we are allowed to author only the first three questions unless…
Q: It has been found that rats with the genotype Ww are more resistant to Warfarin than either WW that…
A: This problem is talking about the Hardy- Weinberg equilibrium. We all know that Hardy-Weinberg gave…
Q: In detail describe the absorption of light energy
A: Chlorophyll containing organisms only have the capability of absorbing energy of sunlight. They use…
Q: Heidelberger observed that complement inhibited the formation of precipitating antigen-antibody…
A: INTRODUCTION Antigen antibody lattice A lattice is formed by crosslinking of antibodies at the…
Q: Question 23 Which process is not an example of post-transcriptional control of gene expression:…
A: Introduction :- Gene expression is the process through which information from a gene is utilised in…
Q: what were the specific skeletal evidence that implicates specific patterns of muscle activity that…
A: Introduction The interior skeleton of a person acts as the body's framework. This framework is made…
Q: Microorganism growth in complex natural environments such as soils and waters can be utilized to…
A: Introduction A living item that must be seen under a microscope to be recognised as a microbe. Only…
Bacterial Genomics
The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.
Transformation Experiment in Bacteria
In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.
Plasmids and Vectors
The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.
5. how rRNAs and tRNAs are processed (in prokaryotic and eukaryotic cells)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…4. RNA can take part in eukaryotic intron splicing but DNA cannot. Describe in technical detail why single-stranded DNA cannot take part in eukaryotic intron splicing, while RNA can.1. Assuming you have determined the sequence of a certain enzyme/protein product, how will you identify its correct DNA sequence (*some codons are redundant or wobbled) using the CDNA libary?
- 1. Create a DNA sequence with eighteen nucleotides. Indicate its 3’ on the left and 5’ on the right since that’s the template strand you will need in the next question to transcribe the mRNA. 2. Transcribe the DNA sequence above and separate the triplets into codons. Indicate 5’ and 3’ in the correct location on the strand. (Don’t worry about splicing- assume that the pre- mRNA is the same as the mature mRNA sequence) 3. Look at the genetic code, and indicate which amino acid is coded for by the codons in the above mRNA. 4. ANSWER BELOW QUESTIONS: A. First write the original DNA strand. Indicate where the substitution was by either circling it or writing it in a different color. Then write the mutated DNA sequence with the point mutation (aka substitution) wherever you choose for it to be. Again, circle it or write it in a different color. Do the same for the transcribed mRNA. Repeat the directions for 2 and 3 for this new DNA stand. (i.e., include the mRNA and translated protein…3. What does miRNA stand for? Please explain its biogenesis?1.List three different mRNA sequences that could encode the amino acid sequence histidyl-alanyl-arginyl-seryl-leucyl-valyl-cysteine.
- 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling in polarities, nucleotides or amino acids as required: ----------Direction of transcription------- DNA Strand 1 3' G G 5' DNA Strand 2 5' G - A 3' - - MRNA codons G A - TRNA anticodons Amino-acids pro1. Discuss the difference between intron and Exon12. The following codons and the amino acids they encode is as follows: AUG = Met UUU, UUC = Phe UUA, UUG = Leu UCU, UCC = Ser CCU, CCC = Pro ACU, ACC = Thr %3D %3D The 5' - ACU-UUC-ACU-AUG-UUU-UUA-UCC-UCC-ACU-CCU-UGA-3' MRNA transcript results in a polypeptide. (a) Give the sequence of amino acids in the primary structure of the polypeptide. (3) (b) Give the sequence of nucleotides corresponding to this transcript in: (i) the DNA strand that was read to produce the MRNA (5) (ii) the DNA strand that was NOT read (the coding strand) (5) (c) How many distinct aminoacyl-tRNA synthetases would be used in the synthesis of this polypeptide? (1) (d) Name TWO characteristics of the genetic code that are evident in the data given in the question. (2)
- 6. Examine the following coding strand DNA nucleotide sequence,^representing the complete gene sequence (i.e. control elements + RNA-coding sequence) of a bacterial gene. Answer the questions below by using the list of consensus sequences and the genetic code. 5' CGCTCAGAAAATTATATTAAATTTCCTCTTGACACTCGCTTTCGTGATCGTCTTATAATGTGTGGATG CCGAAAACGACAATTTCTGACTTACCGGGGTTTTAAGGAGGTAATATGCAAATTAGCGATACCGGCC GCAGCCACACTCCTGACTTTCACGCCTAGTCGCCCGTGAAGACTGGCACAACCAGACCATTACCCACC TTAACCGCCTGCCAGCGCATCCCGTTTTCGCCAGCTGGCGCGATGAGCTTGCCGCCCGCGATTCAGCC CGCGTAGTAAGCGGGCTTTTTTTGGGAGTGGCAGTTCTCTTACGCCCGCAGCCCG 3' Clearly indicate the following directly on the DNA sequence above: promoter elements - underline and label as (a). the sites for initiation of transcription - use an arrow V and label as (b). the sites for termination of transcription – use an V arrow and label as (c). d. Give the sequence of the first 10 nucleotides of the mRNA transcript 5' to 3'. a. b. С.1. Explain why do eukaryotic mRNAs have to be “processed” whereas most prokaryotic RNAs do not?16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid polypeptide: 5'-ATGTGGTCATGA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U A UUU UUC- UUA UUG- CUU CUC CUA CUG- AUU- ACU AUC Ile (1) ACC AUA- ACA AUG Met (M) start ACG GUU GCU GUC GCC GUA GCA GUG- GCG H₂N- U Phe (F) Leu (L) Leu (L) Nonpolar side chains; hydrophobic Val (V) Side chain (R group) H H₂N-C-C-0- HO Glycine (Gly or G) CH₂ H₂N*- CH₂ CH₂ H O Methionine (Met or M) Polar side chains; hydrophilic 0 CH₂ Second base in codon H O Aspartic acid (Asp or D) UCU UCC UCA UCG CCU CCC CCA CCG Alanine (Ala or A) OH CH₂ H₂N-C C 0 H₂N-C C 0 H O Serine (Ser or S) H O Threonine (Thr or T) Electrically charged side chains; hydrophilic OH CH3 CH -0- H₂N+- Acidic (negatively charged) CH₂ H₂N-C-C-O HO C Ser (S) Pro (P) CH₂ CH₂ Thr (T) CH₂ H₂N-C Ala (A)…