Would anyone be able to explain these different channels? I would like an explanation as to why voltage gated membranes are associated with axon membranes (although it's prob because of membrane potential differences and depolarization/hyperpolarization?), why ligand gated channels are primarily at synapses (via neurotransmitters?), etc.
Q: Question:- 1) Plant cells differs from animal cell because 1) it has chloroplast 2) it had cell…
A: The type of cell which contains typical or true nucleolus, i.e nucleus with nuclear membrane,…
Q: Activity: Who's the Real Father? Nathaniel lost his mom Rachel. According to the family lawyer, all…
A: There are mainly four blood groups A, B, Ab and O. These blood groups are named according to the…
Q: In humans, deaf-mutism is a single trait that is controlled by two pairs of genes. The dominant…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: In detail explain how C3 plant leaf is different from C4 plant leaf and why
A: INTRODUCTION the difference between C3 and C4 plant leaves explained below.
Q: Most of the time of the cell cycle is spent in prophase s-phase mitosis anaphase II none of the…
A: Introduction :- A cell's growth and division are accompanied by a sequence of processes known as a…
Q: Cytokinesis is part of telophase I Otelophase II Omitotic phase interphase mitosis s-phase
A: Cell division occurs physically through a process called cytokinesis, in which a parent cell's…
Q: Microorganism growth in complex natural environments such as soils and waters can be utilized to…
A: Introduction A living item that must be seen under a microscope to be recognised as a microbe. Only…
Q: 2) In class we set up the two-compartment model shown below. Assuming we wanted to model intravenous…
A: By separating the single compartment into two distinct containers known as the core and peripheral…
Q: Hos is the contractile vacuole different in appearance from the Amoeba
A: A contractile vacuole is a kind of vacuole that expands to gather water and its accompanying solutes…
Q: Muffy, a color blind female with blood type A (heterozygous to type O) is married to Biff, who is…
A: Given: Muffy, a color-blind female with blood type A (heterozygous to type O), married to Biff, who…
Q: 1. Cardiomyocytes contractile rate increases as Ca2+ levels in cytosol rise. Releasing of Ca²+ to…
A: Cells can respond to environmental signals via signal transduction pathways. A signal is amplified…
Q: The other options are: a. RNA cannot be digested by restriction enzymes b. RNA is small enough…
A: Northern blotting involve separation of RNA fragments by gel electrophoresis. In contrast Southern…
Q: Tell whether the texture of the aerial mycelia of the following molds is loose, compact, wrinkled,…
A: Mycelium : A threadlike network of fungal hyphae is called a Mycelium. It grows in areas where the…
Q: Xanthoproteic test is used to detect amino acids containing an aromatic nucleus in a protein…
A: Introduction Organic substances known as amino acids have both functional groups for amino and…
Q: the bone structure inside the wing of a bird is a clear example of the statement form fix finction.…
A: Density is a one thing that helps with the flying in birds. Hollow bones don't make birds body…
Q: The origins of replication on chromosomes are rich in a certain base-pairing. Which explanation…
A: Origin of replication: The process of replication starts from specific sites on the DNA. These are…
Q: Of what value is Gram staining?
A: Staining the bacteria can be (a) Simple staining that reacts uniformly to all cell types and only…
Q: How early man could easily perceive the difference between inanimate matter and living organisms
A: Traditionally, when we try to define life, we look for specific traits that living things exhibit.…
Q: How do eukaryotic cells degrade unwanted proteins
A: Introduction Large and sophisticated creatures are made up of eukaryotic cells, which have a nucleus…
Q: What particular pathways or enzymes appear distinct for sulfate reducing bacteria in order to…
A: INTRODUCTION : Sulfate reducing bacteria - It is a type of bacteria which can reduce sulfate.They…
Q: Question 4: Does production of high density of leaf hairs affect the response to competition?…
A: A hypothesis in research study refers to a question or idea which needs to be tested experimentally…
Q: Problem 8: Which best describes the genetics of the afflicting allele in the following pedigree (it…
A: A pedigree chart shows the inheritance of a trait. It shows all the individuals of different…
Q: Think about the average yield of ATP in eukaryotic cells. Is it stable or variable? The yield is…
A: ATP stands for adenosine triphosphate. It is an energy molecule that is produced mainly from…
Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'
A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…
Q: A client fell 2 days ago; he has a compound fracture of his left tibia. The physician performed an…
A: A damaged bone can be stabilised and healed using a procedure called open reduction and internal…
Q: IPTG can be used in the laboratory as a synthetic inducer of the lac operon, instead of lactose.…
A: Lactose operon is an example of inducible operon in which the expression of downstream genes will be…
Q: airways clean. Oribosomes Ocell walls O cilia vacuoles microvilli present on the cells of our…
A: Trachea is a long tube that connects your larynx ( voice box) to your lungs . Trachea is often…
Q: Give 4 exercise with the he of anatomical terms in describing the position and positive effect of…
A: Physical exercise is a subpart of physical activity that is intended, structured, and redundant,…
Q: What advantages do human cells have over Amoeba cells?
A: White blood cells (WBC) and amoebas share irregular shapes as their initial similarity. The…
Q: A congenital defect mutates the genes that code for RAG1 & RAG2 making them unreadable (therefore no…
A:
Q: Explain the Methods and standards for disposal of biomedical waste
A: Any garbage that contains infectious (or possibly contagious) components is referred to as…
Q: Which of the following statements supports the endosymbiosis theory (select all that apply)…
A: The dominant evolutionary explanation for the formation of eukaryotic cells from prokaryotic…
Q: You have just started a rigorous exercise. Explain two different ways you can increase blood flow to…
A: Everyone requires physical activity and should be permitted to participate in their chosen…
Q: Molecules transported in the fast phase of axoplasmic transport are: Select all correct answers.…
A: Axoplasmic transport occurs in neurons. It is the transport by which proteins and other substances…
Q: 1. Draw a gel showing the bands/fragments generated from cutting the plasmid below with Sall, BamHI…
A: DNA or proteins are separated via gel electrophoresis based on their molecular weight. It makes use…
Q: 5:00 Which of the following is NOT found in the indicated region of a spermatozoon? S A) DNA C)…
A: We know that Sperm is the male gamete that is produced by spermatogenesis in the testes. They…
Q: Inhibitory interneurons associated with the reflex arc are turned on by glutamate. Group of answer…
A: The brain is the primary organ of the nervous system, accountable for receiving and interpreting…
Q: While characterizing a mutation in a gene of interest, you discover that the mutation involves an…
A:
Q: What are the applications of plant tissue culture?
A: Plant tissue culture It refers to the techniques that are used to preserve or develop plant cells,…
Q: E. it can be used on hair and In anaerobic fermentation pyruvate is further oxidized to lactate or…
A: During aerobic respiration, by the process of glycolysis glucose molecule is broken down into form…
Q: Consider the steps involved during the initiation of replication, explain what will happen if one of…
A: Introduction :- One DNA molecule replicates into two daughter molecules through a process known as…
Q: How is an antibody used to eliminate a pathogen?
A: An immunoglobulin or antibodies are large, Y-shaped blood proteins, which are generated by plasma…
Q: If there is a tiny island in the ocean, that is located 3,000 kilometers away from any other island…
A: Islands are isolated land masses surrounded by water. They are found all throughout the planet, and…
Q: There are multiple potential causes for seizures. Determine which changes to protein function could…
A: Seizures - are neurological disorder, caused due to imbalance between excitatory & inhibitory…
Q: How might the environment influence whether a fungus reproduces sexually or asexually?
A: Fungi can reproduce sexually or asexually and the choice depends on the presence of environmental…
Q: Sexual reproduction involves crossing-over to mix up genes. Is this a good thing or a bad thing? In…
A: Sexual reproduction is a type of reproduction that involves a complex life cycle in which a gamete…
Q: Which of the following is false about cyclin-cdk complexes? Cdk's do not have to bind to cyclin…
A: Cdk/cyclin complexes phosphorylates proteins required to trigger next cell cycle phase - this…
Q: Compare and contrast between mitosis telophase and meiosis telophase I
A: Mitosis and meiosis are types of cell division that are seen in both plants and animals. Mitosis is…
Q: 1. In rabbits, coat color is affected by a series of alleles with a hierarchy of dominance such that…
A: A succession of alkenes with a dominance hierarchy impacts coat color, such that c+>cch>ch>…
Q: What are three functions of the cell nucleus? What are two functions of a plant cell vacuole?
A: Introduction: Nucleus: The largest and most noticeable organelle inside the cell is the nucleus. The…
Would anyone be able to explain these different channels? I would like an explanation as to why voltage gated membranes are associated with axon membranes (although it's prob because of membrane potential differences and depolarization/hyperpolarization?), why ligand gated channels are primarily at synapses (via neurotransmitters?), etc.
Step by step
Solved in 2 steps
- Why is the action potential conducted in only one direction in a neuron? Comments : Best of your knowledege for grasp the concept wellWhich ion channel is responsible for the release of neurotransmitters from the presynaptic neuron? Voltage-gated CI- channels Stress-activated cation channels Leaky K+ channels Voltage-gated Ca+2 channels Voltage-gated Na+ channels re to search 73The membrane voltage in graded potentials can be produced by Oopen channels and ligand-gated chanels Ovoltage-gated channels Oligand-gated and mechanically gated channels Oligand-gated channels mechanically gated channels
- Connexons of gap junctions in electric synapses :-a- are Ligand-gatedb- are voltage-gatedc- allow transmission of potential changes in both directions between the pre- and post- synaptic neuronsd- close whenever the presynaptic neuron becomes hyperpolarizedThis is a Multipolar Neuron, please use ARROWS to label the following: Soma nucleus glial cells dendrites axonWhere in a myelinated axon are nearly all of the ion channels concentrated? options: the cell body nodes of Ranvier dendrites axon terminals
- Nerve transmission and communication with other neurons. DI it restores the membrane potential the chemical that talks between one neuron and the other neuron the point between the neuron and the muscle transmits impulse to dendrite it carries receptors on its surface it produces the neurotransmitter 1. Neurotransmitter 2. Presynaptic membrane 3. Postsynaptic membrane 4. Nat-K+ pump 5. Neuromuscular junction 6. AxonIf a potassium channel is held open for even longer, leading to an even bigger hyperpolarization of the cell what will happen in an afferent neuron? action potentials will have a larger amplitude action potentials will have a small amplitude less frequent action potentials in the neuron more frequent action potentials in the neuronWhich of the following are TRUE, when describing the Action Potential of a Non- Contractile Cardiac Pacemaker cell? Select ALL that are true. O Resting membrane potential is more polarized than in neurons, because of more Leakage channels for K+. Progressive Na+ channel (the "funny current", iNa) opening, activates a Transient Voltage Sensitive (T-type) Ca++ channel. Together these channels depolarize the membrane and activate Voltage-Sensitive Long-acting (L-Type) Ca++ channel. The resulting depolarization, closes the "funny" current and T-type Ca++ channels. O Action Potential depolarization, resulting from the Voltage-Activated Na+ channel, triggers Voltage-Sensitive Long-acting (L-Type) Ca++ channel. OMembrane depolarization triggers Voltage-Activated K+ channels (Delayed Rectifier) to open. Increasing K+ permeability and repolarizing the membrane. When the membrane polarizes to -60 mv, the Delayed Rectifier closes and a progressive Na+ channel (the "funny current", iNa) opens. The…
- Axon can't branch Afferent neurons are generally bipolar neurons Most neurotransmitters are synthesized in the cytosol of a neuron GABA is the most common inhibitory neurotransmitter in the central nervous system Tendons are regular dense connective tissue that connect muscles to boneWhich of the following describes a threshold potential? A brief reversal of the charge difference across a neuron's plasma membrane The membrane potential at which voltage-gated sodium channels in a neuron axon open, causing an action potential The membrane potential of a neuron at restwhich of the following is not functional neeuron?? sensory afferent efferent interneuron connecting