Which of these is the function of a poly (A) signal sequence? A. It adds the poly (A) tail to the 3' end of the mRNA BR codes for a sequence in eukaryotic transcripts that signals termination of transcription-10-35 nucleotides away C. It allows the 3' end of the mRNA to attach to the ribosome D is a sequence that codes for the hydrolysis of the RNA polymerase It adds a 7-methylguanosine cap to the 3' end of the mRNA

Which of these is the function of a poly (A) signal sequence? A. It adds the poly (A) tail to the 3' end of the mRNA BR codes for a sequence in eukaryotic transcripts that signals termination of transcription-10-35 nucleotides away C. It allows the 3' end of the mRNA to attach to the ribosome D is a sequence that codes for the hydrolysis of the RNA polymerase It adds a 7-methylguanosine cap to the 3' end of the mRNA

Name: 39/50Which of these is the function of a poly (A) signal sequence?A.
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 39/50Which of these is the function of a poly (A) signal sequence?A. It adds the poly (A) tail to the 3' end of the mRNAB It codes for a sequence in eukaryotic transcripts that signalstermination of transcription-10-35 nucleotides awayC. It allows t

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

The Lariat Intermediate in RNA Splicing Draw the structures that comprise the lariat branch point formed during mRNA splicing: the invariant A. its 5â€™-R neighbor, its 3â€™-Y neighbor, and its 2â€™-G neighbor.
Please help with all parts of A, B, C, D 2. You are studying the function of a messenger RNA named Genetixrox and want to label themRNA with a radioactive atom. Assume the mRNA is long and contains all four standardRNA bases. Assume that the cell cannot convert ribonucleotides to deoxyribonucleotides (orvice versa).A. Will you generate radioactive Genetixrox mRNA with 3H-threonine? Threonine is an aminoacid. Answer yes or no, and provide a one sentence rationale.B. Will you generate radioactive Genetixrox mRNA with 3H-adenosine triphosphate? Answeryes or no, and provide a one sentence rationale.C. Will you generate radioactive Genetixrox mRNA with 3H-deoxyadenosine triphosphate?Answer yes or no, and provide a one sentence rationale.D. Will you generate radioactive Genetixrox mRNA 12C-with adenosine triphosphate? Answeryes or no, and provide a one sentence rationale
5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
37. A portion of an mRNA attached to a ribosome reads: 5′ UUUGACCCCACG 3′ If a tRNA with an aspartic acid amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? What amino acid will be attached to the amino group of the histidine encoded by this mRNA?
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′
19Eukaryotic messenger RNA and hnRNA both have poly (A) tails at their 3'-ends. Yesorno 20Messenger RNA splicing and export are uncoupled processes. Yesorno twenty oneWhich of the following plays an important role in directing newly synthesized proteins to specific cellular destinations?A.signal sequenceb.nuclear localization signalc.chain elongation stretchD.Shine – Dalgarno
Consider the following mRNA base sequence 5' CUU CAG 3 a What dipeptide is coded for this mRNA? b. What dipeptide is formed if a point mutation converts CUU to CUC? c. What dipeptide is formed it a point mutation converts CAG to AAG?
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′
Help me figure out how I should interpret and read these graphs. We are looking to see whether the m6a acceptor mutant will have an impact on splicing. Just need a detail breakdown thanks. I am presenting at journal club and need help interpreting will the goals in mind. We are currently conducting experiments to understand how the splicing of circE7 relates to the splicing of linear E6*I. Goal is to determine whether the mutation impact splicing. Trying to understand whether m6A will impact splicing. Sm should impact splicing ratio. My PI stated that the results show that it inhibited linear splicing and promoted backsplicing. I need a detailed explanation for the entirety so I can understand
From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using ONE-letter amino acid code starting from N-terminus to C-terminus and using THREE-letter amino acid code starting from N-terminus to C-terminus
During translation, the tRNA antlicodon sequence G-A-U vyould blnd to which MRNA codon (plck one of the cholces I -V below)? Note: all of the sequencos for tho quostlon and answors use the standard convention for representing ollgonuclootidos discussed In class whoro tho 5'-ond Is at the loft and the 3'-ond Is at the right. I) G-A-U II) U-A-G I) C-U-A IV) A-U-C V A-T-C OA. none of the cholces OB. IV Oc." OD.! OE, II
Suppose an mRNA transcript with the following base sequence reaches a ribosome: 5' AUGCGUUAUGGCUACUGA - 3' Give the primary structure of the protein that the ribosome will build, by writing the 3-letter codes of the amino acid residues in the usual order (N- to C-terminus). If there is more than one possible protein that will be produced, write the amino acid residue sequence for any of them. You will find some useful information about the genetic code and amino acids in the ALEKS Data resource. I Don't Know Submit O 2022 McGraw Hill LLC. All Rights Reserved. Terms of Use Privacy Center | Acce DELL F4 F10 F11 F12 PrtScr Insert Delete PgL F1 F2 F3 F5 F6 F7 F8 F9 "R %2# $4 & Backspace