Which of the following graphically shows the evolution of protein sequences? O Blosum-62 BLAST O identity-based system O sequence template evolutionary tree
Q: Reports in the media about stem cells usually state that they “turn into any kind of cell in the bod...
A: There are few points to know about stem cells are: We know that stem cells have quality to to devel...
Q: habitual tradition of drinking cow’s milk?
A: Cow Milk: Cows' milk is a nutrient-dense food consisting of varying amounts of carbohydrates, fat, a...
Q: Enumerate and discuss the illuminating parts of the microscope and give their respective functions
A: Note: As Per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Th...
Q: nswer is anaerobic respiration similar to glycolysis. Provide three reasons to justify your answer. ...
A: The process by which organisms combine oxygen with foodstuff molecules and produced the chemical en...
Q: Please match the tissue to the description. covers the ends of bones in a joint [ Choose ] [ Choose ...
A: Cartilage. This is a type of tissue that covers the surface of a bone at a joint. Cartilage helps re...
Q: DIOL 3030- Practice Te Below is a figure depicting the phylogenetic relationship of eight flowering ...
A:
Q: Choose one example of pseudoscience (Bigfoot, ghost hunting, homeopathy, phrenology, visions, astrol...
A: Homeopathy is a medical approach founded on the principle that the body has the ability to heal itse...
Q: What is a tissue cell
A: All the life forms are composed of one or more cells.
Q: Recognize the importance of adaptation and evolution to life ?
A: The community in which creatures are left together by interacting with each other to support their l...
Q: What are the advantages of applying a fungicide to seeds? Would it be better to apply a contact fung...
A: The prospective performance of a seed batch is defined by seed quality. Seed quality is affected by ...
Q: describe the difference in color between the leaf which was fully exposed to sunlight and the one wh...
A: The process by which green plants and some other lower living beings prepare their food in the prese...
Q: 1. How can you tell which side of the heart is the ventral surface when you examine it on your disse...
A: The ventral (Latin - venter means 'belly') surface refers to front, or lower side, of an organism.
Q: Instructional Technology Subsidy U.. DISMISS MULIIPLt CHUILE Why do males tend to inherit more sex-l...
A: Introduction:- A pair of sex chromosomes, XY in men and XX in females, determine biological sex in h...
Q: What is Type II schizophrenia ?
A: Schizophrenia is a mental disorder where an individual has mental inabilities which affects a person...
Q: Consider the following situation: The replicated chromosome 9 is separating during anaphase of mitos...
A: Introduction: A telomere is a segment of repetitive sequences found at the ends of most eukaryotes'...
Q: 8. Cross a parent with ii Blood type with a parent IAIB Blood type. What are the phenotypes and geno...
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...
Q: Which of the following is typically true concerning the difference between Deciduous Forests and Con...
A: Deciduous forests are characterized by the presence of deciduous trees such as oaks, basswoods, and ...
Q: Find a fish of the body types listed below. Not all fishes can be described by one of these terms. P...
A: Answer : Adaptation is an important survival skill in all species. Adaptations are changes an organi...
Q: ons
A: Answer--
Q: Rate of evolution by selection is highest for an allele when it is _________ . a. wild type b. reces...
A: Evolution has been the key to the development in the world. From evolution of organic molecules from...
Q: How does temperatire, precipitation, humidity affect the distribution of Pinus massoniana?
A: INTRODUCTION In the biodiversity the terrestrial ecosystem played a major role in the global ca...
Q: Why does amplitude decrease in a train of action potential
A: Nerves transmit impulses to and from the central nervous system. Twelve pairs of cranial nerves conn...
Q: What protein does the P53 code for and why is it important?
A: Answer :- The TP53 quality gives guidelines to making a protein called growth protein p53 (or p53). ...
Q: Briefly describe the differences among plantigrade, digitigrade and unguligrade in terms of their ad...
A: Plantigrade : In this Humans and Bears put the whole feet on the ground for locomotion. Digitigrade ...
Q: As all ecosystems are connected, in the warming sea temperature, what techniques are used to create ...
A: A stream is considered as a water body whoch is known to carry a number of particles of rock and fur...
Q: a cancer causing virus causes --- in susceptible cultured cells. a. foci b. plaques 2. Lack of ass...
A: 1. foci
Q: How does the Down Syndrome affects the cell’s ability to reproduce? Explain the difference between a...
A: Down syndrome is a genetic disorder caused by an extra chromosome 21 due to a genomic mistake during...
Q: Fragile X syndrome What are the symptoms or characteristics of this disorder or trait? What is the ...
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...
Q: Several members of the family in the pedigree who suffered from a disease are colored in black. Curr...
A: As per the pedigree shown this disease has x-linked recessive mode of inheritance. This is based on ...
Q: g best describes the complete sequence of steps occurring during every cycle of PCR? I-The primers h...
A: A laboratory method used to make many copies of a specific piece of DNA from a sample that contains ...
Q: Discuss the ease of hydrolysis (break down) for each of the 4 polysaccharides (glycogen, amylose, am...
A: Food is an important energy source to carry on the normal physiological functions of the body. Plant...
Q: 1. DNA → CCT CTT ATG ACA CGG AGG GTA CGC TAT TCT ATG TÀA TECATA ATC mRNA → tRNA →CCI protein >
A: Following the discovery that DNA is the genetic material, a new field known as genomics arose. DNA, ...
Q: A footwear company wants to test the effectiveness of its new insoles (soft insole and air-fill inso...
A: Various forms of study designs are there that can be used by researchers in order to obtain evidence...
Q: Activity 2: Write the probable causes for the creation of the Global Aliance for vaccines and Immuni...
A: The GAVI Alliance is a global health partnership of public and private sector organizations dedicate...
Q: Chemotrophic energy metabolism is a catabolic and exergonic process that produces ATP from oxidizing...
A: Chemotrophs are organisms that get energy through the oxidation of electron givers in their environm...
Q: how do insects defend themselve
A: Insects are crucial components of many ecosystems, where they perform many important functions. They...
Q: Describe two mammal order, structures, and behaviors.
A: Mammals Mammals are the vertebrate animals which have warm blood and hairy body.
Q: Define Mitochondrial Mutations- Human Genetic Disorders ?
A: The cell is the fundamental unit of life. A tissue is a collection of cells that work together to fu...
Q: Please answer fast What is CCR5 and what is its importance to human health?
A: Note: According to the bartleby guidelines only first question is to be answered. So please upload o...
Q: .Examine the Punnett squares below and select the letter(s) of the crosses that are correct. More th...
A: Reginald C Punnet invented the punnet square, which bears his name. It is used to predict and illust...
Q: Tay-Sach's disease is caused by one gene. The disease is recessive. Is it possible for two healthy...
A: Introduction :- In the first 3 to 6 months of life, babies born with Tay-Sachs develop normally. The...
Q: 5 uses of Isotopes in the medical field
A: In health, agriculture, industry, and research, radioisotopes and enriched stable isotopes are frequ...
Q: make a slogan that will raise the awareness of the students and to help eliminate sexually transmitt...
A:
Q: Fragile X syndrome why is interesting Fragile X syndrome What are the symptoms or characteristics o...
A: Fragile X syndrome also known as Martin-Bell syndrome, is an inherited condition that causes develop...
Q: The importance of having these checkpoints in the specific phase of the cell cycle. 10 sentences
A: Transformation of cells from one phase of the cell cycle to another is controlled by some external f...
Q: medical laboratory safety management
A: The medical laboratory is a naturally dangerous place, with fire barriers, hazardous chemicals, and ...
Q: 284
A: The Gs alpha subunit (Gαs, Gsα) is a subunit of the heterotrimeric G protein Gs. Gs alpha subunit is...
Q: Describe how fertilizers affect disease severity. Give three examples of fertilizer practices that i...
A: Fertilizers can be described as the chemical substances that are administered to plants in order to ...
Q: How can Biuret test be extended to quantitatively measure the concentration of protein
A: Proteins are the polymers of amino acids.
Q: What did Stephen Jay Gould offer to our current understanding of evolution?
A: Evolution is the change in characteristics which occur over a period of time and relies on natural p...
Please answer fast
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertionThe sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'
- Second Base Analyze the following DNA sequences: A UUU UCU UAU UGU Phe Tyr UUC UCC UAC UGC Original: AGAGAGAGAGAGAGAGAG Ser UUA UCA UAA Stop UGA Stop Leu UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU His Mutated: AGAAGAGAGATCGAGAGA CUC CC CAC CGC Leu Pro Arg CỦA CCA CAA CGA Gin CUG CCG CAG CGG AUU ACU AAU AGU Ser Asn What amino acid sequence will be translated based on the AUC Ile ACC AAC AGC The mutated DNA? Hint* must transcribe and translate the AUA ACA AGA AAA arg Lys Met or Start AUG ACG AAG AGG mutated strand to find the answer. GUU GCU GAU GGU Asp GUC GCC GAC GGC Val Ala Gly G GUA GCA GAA GGA Glu GUG GCG GAG GG First Base Third BaseGiven the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’The same DNA sequence as in Questions # 2-4 is rewritten below (Sequence #1). Sequence #2 is the result of a mutation within the original (#1) sequence. Select all of the following words that apply to this mutation: Second letter A First letter U A G UUU UUC UUA UUG U CUU CUC CUA CUG GUU GUC GUA GUG Oinsertion Odeletion Osubstitution Phe Osilent Omissense Ononsense Oframeshift Opoint Leu Leu AUU AUC lle AUA ACA AUG Met ACG C Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCG Ser Pro Thr Ala CAU CAC CAA CAG AAU AAC AAA AAG UAU Tyr Cys UAC UAA Stop UGA Stop A UAG Stop UGG Trp GAU GAC GAA GAG His Gin Asn Lys Asp G Glu UGU UGCO CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Arg Ser Arg DOAG DAG DUAG UCAG Third letter Gly Sequence #1: 5'-ATGCACGGCGACTAG-3' Sequence #2: 5'-ATGCTCG GCGACTAG-3'
- Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?C 2 ⒸCP Biology 2022-2023 Unit 7 Pro x app.formative.com/formatives/63403369f912f69144853e8b 3 Type here to search -A FA -C FG C FA FT G T- T- Ú G- W A- ·U FA - C C CP Biology 2022-2023 Unit 7 Pro X Amino Acid GUA (2) CAU ㅗㅗㅗ | + DELL Amino Acid GCG C G C -Nuclear Membrane > Amino Acid A A A UUU Cytoplasm @4 JTable I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?
- A piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNA fragment, and set up a series of four dideoxy reaction. You then separate the products of the reaction by gel electrophoresis and obtain the following banding patter: ddATP ddTTP O 5'-ATTCGACT-3' O 5'-TCAGCTTA-3' What is the base sequence of the synthesized fragment? O 5'-AGTCGAAT-3' ddCTP O 5'-TAAGCTGA-3' I ddGTPWhat is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATTWhich two species in this DNA sequence alignment are the most closely related? Explain your answer referring to specific nucleotide positions to justify the choice you made.