Which feature of protein folding is NOT accurate?
Q: Acidosis is a human body disorder caused by too much acid in the stomach. If a patient was tested…
A: Acidosis is a condition in which the body's fluids contain an abnormally high level of acid. It is…
Q: hich of the following play an important role in synthesis of DNA/RNA: a.B-12 b.Folic acid c.Sodium…
A: The RNA is synthesized by RNA polymerase enzymes from a DNA template through DNA transcription.…
Q: Do "Enzymatic Browning reaction is intensified with the presence of oxygen?.
A: Introduction Enzymatic browning is a chemical process that we can see in fruits, vegetables etc. .…
Q: evidence of Bial's test to show a positive result for the presence of a specific sugar
A: Bial's test is a chemical test used to test for Pentose sugar. It includes chemicals like orcinol,…
Q: Calculate the frictional coefficient of a molecule of DNA of 20 base pairs in water at 20C; assume…
A: DNA or deoxyribonucleic acid is a polynucleotide chain made of monomeric units of nucleic acids.…
Q: Why are vascular tissues important?
A: The vascular tissue system is made up of a number of vascular bundles that are found throughout the…
Q: HN H3Ñ® Where on this amino acid does it attach to a primary sequence of a protein and where is the…
A: Given amino acid, Histidine is a basic amino acid. The structure of Histidine is presented as a…
Q: _____ 1. is the classification of enzyme where carbonic anhydrase belong ______ 2. is the name of…
A: The reaction catalyzed by carbonic anhydrase is given below. H2O + CO2⇌ H2CO3 ⇌ HCO3- + H+. The…
Q: Which of the following contains the most lipids? A. Banana B. Champorado C. Olive oil D. Cheese
A: Different food items consist of different micro and macronutrients. Few of the macronutrients are…
Q: On a mass basis, fats are more efficient sources of energy than carbohydrates but carbs may be…
A: Carbohydrates are the basic components of our food. It is organic compounds produced in the…
Q: Identify the ligand that bind to uniprotkb-P39086, the type of allostery, and describe the general…
A: P39086 is an ID for a protein GRIK1_HUMAN that belongs to Homosapiens. It is a protein of 918 amino…
Q: E. How many nucleotides would be required to generate a polypeptide that is 15 amino acids long?…
A: The genetic code is a sequence of three-letter combinations of nucleotides called codons, each…
Q: Modified true or false. If false, replace the underlined word with the correct answer.
A: Glycolysis is a metabolic pathway, through which the glucose molecules are metabolized to synthesize…
Q: Describe the common strategy (steps) for protein sequencing, starting with a biological sample…
A: Proteins are one of the 4 major biomacromolecules. Proteins are the most abundant of the 4…
Q: Is it true that there is no such thing as vitamin overdose? For the fat-soluble vitamins, list down…
A: Although dying from a vitamin overdose is exceedingly rare, there were confirmed cases of death due…
Q: How many molecules of Pyruvate can form from Glycerol metabolism as a by-product of fatty acid…
A: The major precursors of gluconeogenesis are lactate, glycerol, alanine, ketone bodies like…
Q: Hormone Testosterone Function Name and Structure of attached molecule
A: Living things coordinate their activities at every level of their organization through complex…
Q: Which statements are associated with positively cooperative oxygen binding of a protein? A. The…
A: Haemoglobin is a tetrameric protein. It is a heterotetramer consisting of two alpha subunits and two…
Q: Enumerate the types of carbohydrates unit and explain each
A: A carbohydrate is a biomolecule composed of carbon, hydrogen, and oxygen atoms in a 2:1…
Q: State those enzymes involved in tricarboxylic acid and explain each.
A: The tricarboxylic acid cycle (TCA cycle) is a common metabolic pathway located in mitochondrial…
Q: For questions #23 - #27 A solution is made by dissolving 6.26g NAOH in 25.2g water. 19. What is the…
A: The number of moles of any compound is found by making use of formula: number of moles=given…
Q: Table Q1(a) shows typical values for the intracellular and extracellular concentrations of the major…
A: All cells have an electrical potential difference or membrane potential across their plasma…
Q: Yeast yields ethanol from pyruvate in two steps. Step one requires the co-enzyme __ , which is…
A: Pyruvate dehydrogenase catalyzes this oxidative decarboxylation of pyruvic acid. Complexity refers…
Q: Calculate the concentration of a-ketoglutarate if the concentration of isocitrate is 18.9 mM and the…
A: Lets assume that all the given concentrations are equilibrium concentrations and we are expected to…
Q: The citric acid cycle occurs in the O smooth endoplasmic reticulum. mitochondrial matrix. nucleus.…
A: The TCA cycle, also known as the Krebs cycle, takes place in the mitochondria and generates a…
Q: Interpret the two chromatograms below. Which of the two chromatograms will provide good sequencing…
A: In Automated DNA sequencing, using a laser the different fluorescent labelled nucleotides at the end…
Q: 2. Draw out a labeled diagram explaining all the following processes: Gel Filtration Chromatography…
A: Gel Filtration Chromatography: Gel Filtration chromatography is method in which molecules in a…
Q: Current research indicates that the cause of obesity is multifactorial. Briefly outline the roles of…
A: Obesity is a major health issue in developed countries, and it has become increasingly clear that…
Q: E.coli cell?
A: E.coli(Escherchia coli),is a gram-negative,facultative anaerobic,rod shaped,coliform bacterium of…
Q: body fat muscle proteins carbohydrates fiber glycogen Fasting decreases the intake of body breaks…
A: Answer Fasting decreases the intake of carbohydrates which is needed for energy. Without this the…
Q: list ALL redox reactions that occur during cellular respiration. At the end of your list, how many…
A: Redox reactions involve many reactions from cellular respiration, in which electrons are passed from…
Q: Glycolysis is an energy-generating pathway. How much of each of the following is produced when…
A: Glycolysis is the process in which one mole of glucose is oxidized to two moles of pyruvate. It…
Q: State other biologically and commercially polysaccharides then give its commercial uses
A: Polysaccharides are the most common type of carbohydrate present in foods. They are biopolymer…
Q: What is the MAJOR product of the reaction catalyzed by rubisco in the Calvin cycle? Select one:
A: The Calvin Cycle is the part of the light independent reactions of photosynthesis, that widely uses…
Q: What are the different solid phases that antibody or antigen can bind to, in ELISA?
A: Quantitative immunological techniques that use a solid phase can be defined as solid-phase…
Q: Substrates for the first reaction of fatty acid synthesis are linked to dolichol phosphate carrier…
A: fatty acid synthesis is the process of creation of fatty acids from acetyl Co-A and NADPH through…
Q: Complete table 2. * Since you were not able to conduct an actual experiment on these tests, kindly…
A: Bromine test is a qualitative analysis of organic chemistry to detect unsaturation, anilines and…
Q: ______ 1. is the name of the enzyme that catalyzes the hydration of carbon dioxide to bicarbonate…
A: Enzymes are biocatalysts which increase the rate of biochemical reactions. The CO2 formed in the…
Q: In addition to cleaving peplides, chymotrypsin can akso catalyze the hydrołysis of certain small…
A: Hi! Thank you for the question. We are authorized to answer one question at a time, since you have…
Q: Use the data below to determine the maximum velocity [in mM/s] of a certain enzyme-catalyzed…
A: We must know the Michaelis Menten equation: V=Vmax [S]Km+ [S]
Q: PKA is activated after its regulatory subunit is dissociated from the catalytic subunit. Select one:…
A: Hi! thankyou for the question. Since the questions belong to different concepts, we are authorized…
Q: Propose a mutation for Uniprotkb-P39086 and it’s effec
A: Mutations are the result of damage or alteration of a DNA gene such that the genetic message it…
Q: What kinds of effects can occur on cellular metabolism when we introduce genetic modifications into…
A: Metabolism is driven by specific enzymetic products of gene expression , and gene expression…
Q: If a base, such as sodium hydroxide (NaOH) were added to milk, would the protein precipitate? Why or…
A: Milk is a great source of vitamins and minerals, especially calcium. Milk plays a crucial role in…
Q: Total Number of NADH Obtained from one Pyruvate Molecule Total Number of FADH2 Obtained from one…
A: In respiring bacteria pyruvate is further oxidized after it is transported into mitochondria that is…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: The following bond makes bovine pancreatic trypsin inhibitor as one of the stable proteins.…
A: Introduction: Bovine pancreatic trypsin inhibitor (BPTI) binds to trypsin and prevents peptide…
Q: Describe the morphology and identification of Group A Streptococcus
A: Streptococci are microscopically bacterial coccoid cells, as well as a Gram-positive color when Gram…
Q: Draw and explain how SMC1 and SMC3 proteins form a heterodimer.
A: SMC1 and SMC3 proteins are involved in the formation of a heterodimer complex during the process of…
Q: acetate buffer works on fumarase activity but tris-maleate buffer does not
A: Fumarase is an enzyme that catalyzes reversible conversion of fumarase to malate in TCA cycle.…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- At what level of protein structure (primary, secondary, tertiary, or quaternary) will protein structure be initially altered? A mutation in the genetic sequence, which ultimately causes an amino acid to change(e.g. Trp – Asn – His turns into Trp – Arg – His) Dissolving a protein in a non-polar solvent (like oil) instead of water.Based upon your knowledge of protein folding, which of the following statements would you expect to be FALSE: O The native state is the protein conformation with the most negative Gibbs free energy value. O The hydrophobic effect causes non-polar side chains to pack into the interior of a protein away from solvent. Proteins are likely to try out every possible conformation before folding into the native state. O A protein incubated in hexane (C6H14) is likely to denature and unfold. O Detergents can interact with the side chains of valine, leucine and phenylalanine.Proper folding of proteins is essential for their biological activity. In general, the functional conformation of a protein is the conformation with lowest energy. This means that if an unfolded protein is allowed to reach equilibrium, it should assemble automatically into its native, functioning folded state. Why then is there a need for molecular chap- erones and chaperonins in cells? What different roles do molecular chaperones and chaperonins play in the folding of proteins?
- Which of the following statements about protein folding and structure are true? Check all that apply. Chaperones, like the GroEL-ES complex, work by providing a sequestered environment in which proteins can safely explore the conformational space towards productive folding. O Chaperones "know" how to actively fold proteins into their proper final structure. Each protein has its own "assigned" chaperone to assist in its proper folding. O Misfolded proteins are innocuous and readily cleared by the cell. V The native structure of a protein is entirely encoded in its amino acid sequence. Misfolded proteins often aggregate in large structures in the cell. Misfolded proteins are thermodynamically stable versions of a protein.Which of the following constitutes the primary structure of a protein? O the folding of a polypeptide chain the polypeptide chains stacked on top of each other O the linear sequence of amino acids in a polypeptide chain several polypeptide subunitsProper folding of proteins is essential for their biological activity. In general, the functional conformation of a protein is the conformation with lowest energy. This means that if an unfolded protein is allowed to reach equilibrium, it should assemble automatically into its native, functioningfolded state. Why then is there a need for molecular chaperones and chaperonins in cells? What different roles do molecular chaperones and chaperonins play in the folding of proteins?
- Protein denaturation is the disruption of a protein's secondary to quaternary structures. Protein denaturation is always reversible. [, O The FIRST statement is TRUE. O The SECOND statement is TRUE. O BOTH statements are TRUE. O NONE of the statements are TRUE.Which of the following levels of protein architecture is least likely affected by changes in pH? O Secondary Structure Quaternary Structure O Tertiary Structure O Primary StructureWhich of the following statements best describe(s) the mechanism by which correct protein folding takes place once the misfolded protein binds the open ring of groEL? Select all that apply. The groEL ring closes to isolate the protein and provide enough time for the protein to properly fold on its own. b and d The groEL ring closes to provide a hydrophilic space to isolate the protein and inhibit its aggregation with others until properly folded. The groEL ring closes to isolate the protein and provide steric hindrance that mechanically refolds the protein. The groEL ring closes to isolate the protein and decode the information necessary to achieve the correct three-dimensional structure. None of the above I picked "The groEL ring closes to provide a hydrophilic space..." but it was incorrect..
- Which of the following amino acids are more likely to be on the interior of the protein? And which are more likely to be exposed to the surface? L I D E W A V K H M Q YWhich statement is true about protein folding? ○ The equilibrium between folded and unfolded states is best determined by measuring the time course of unfolding ○ Refolding of a protein typically exhibits a linear dependence on the concentration of denaturant ○ The sigmoidal shape of the unfolding transition reflects the complex architecture of proteins ○ Proteins with stable folding intermediates usually exhibit smooth free-energy funnels ○ The rate of unfolding increases as the temperature increases towards the Tm valueIn the following diagram of a portion of a protein, label the types of interactions that are shown. What level of protein structure are these interactions producing?