What is the role of his119 in the RNase-catalyzed hydrolysis of RNA, as indicated in the Figure below? RNA 5' -O–CH2 O Base 4' H H His 119 3 OTH O–CH2 H H ΝΗ His 12 Base H O -0-P=0 H OH It acts as a general base, abstracting a proton from the 2' hydroxyl in order to increase its nucleophilicity. It forms an H-bond with his12 in order to stabilize the transition state. It serves as a general acid, donating a proton to improve the quality of the leaving group. It works through concerted general acid-base catalysis with his 12 in order to favour the products of the reaction. Two of the above are true.
Q: The pharmaceutical applications of the compound shown HO OH OH OH OH O A. Chemical substrate for…
A: Sorbitol less commonly known as glucitol.It is a sugar alcohol with a sweet taste which the human…
Q: CO,+H20+ HCO3 → H+ + HCO3
A: Here, we are given the reaction taking place in the bicarbonate buffer. Blood plasma is buffered…
Q: 200 microliters of a standard solution of 0.200 mg/mL caffeine was mixed with 4.8 mL of 50 mM sodium…
A: Equation of dilution: M1 × V1 = M2 × V2where:M1 is the molar concentration of the stock solution.M2…
Q: The dominant motif found in hemoglobin and myoglobin is: a) twisted beta sheet b) beta barrel c)…
A: 1)The dominant motif found in hemoglobin and myoglobin is (b) beta barrel.2)myoglobin consists of (d…
Q: For the reaction E + S ES, what is the [E] if [S] = 0.18 mM, [ES] = 133 uM, and the Kd = 15 uM?…
A: Answer :- The enzyme in this reaction is denoted by E, the substrate by S, and the complex of the…
Q: Oxygen is mainly carried through blood in what form?
A: Oxygen is essential for ATP generation through oxidative phosphorylation, and therefore must be…
Q: 6 9 ation Which of the following is an unacceptable structure of a monosaccharide sugar? А. C. HOCH2…
A: Monosaccharides are the most simple sugars/carbohydrates. These are composed of carbon, hydrogen and…
Q: What is the relationship between lactate production and lactate remov
A: Lactate production and lactate removal are closely related processes in the human body, both of…
Q: What is the effect of type 2 diabetes (T2D) on pentose phosphate pathway (PPP) flux? T2D facilitates…
A: In type 2 diabetes, the cells do not respond normally to insulin. The body develops what is known as…
Q: The cytochrome P450 family of monooxygenase enzymes are involved in the clearance of…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Case Study: Enzyme Kinetics Data for new statin drug (inhibits HMG CoA reductase): I Substrate (UM)…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: 4. Graphing the results from kinetics experiments with enzyme inhibitors The following kinetic data…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Match each characteristic to the appropriate process. Anabolic process breaks down macromolecules…
A: Metabolism is the sum total of all chemical reactions taking place in lifeforms. It can be divided…
Q: trapezius muscle,
A: Trapezius muscle:This muscle is a large superficial (kite-shaped) muscle which is located on the…
Q: structure so they can which below, II. While there are many different types of inhibitors, most have…
A: Hello! Thank you for the question. Since we do not have the information regarding the amino acid…
Q: 8. For the following molecule, draw the monomers *Hint* there are three different monomers a. What…
A: Monomers are defined as simple units which undergo polymerization to form large and complex…
Q: You have a mixture of peptides (RE; EQ; DW; EE; KG). Which peptide will bind most strongly in a…
A: Recall that:Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…
Q: 1. Start with the Michaelis-Menten equation and convert it to a double-reciprocal equation. Show how…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: 2 T/F High intracellular concentrations of AMP would increase the ATP-synthesis pathways A mutation…
A: ATP is the currency the cell spends on metabolic transactions. Acetyl CoA is one of the substrates…
Q: Which of the following stretches of RNA is most likely to form a hairpin with 4 bases making up the…
A: A nucleotide (pentose sugar + nitrogenous base + phosphate group) is a phosphoric acid ester of a…
Q: Biktarvy, shown below, is a new drug that is being investigated for the treatment of HIV. но OH F…
A: In biochemistry a functional group is a group of atoms that is responsible for the chemical…
Q: Draw the structure of the peptide DTLH, showing the backbone and side-chain atoms, at its…
A: There are four classes of biological macromolecules - proteins, nucleic acids, carbohydrates and…
Q: The hormone which regulates pH in the intestine is called: a) cholecystokinin b) secretin c)…
A: The objective of the first question is to identify the hormone that regulates pH in the intestine.…
Q: What is the structural feature common to ATP, FAD, NAD and coenzyme A (CoA)? a hexose sugar three…
A: Molecule called Adenosine Triphosphate (or ATP) acts as cellular energy source. The phosphates in…
Q: Congratulations! Due to your success in Dr. Daniel's Cellular Metabolism class. You have been…
A: A reaction is said to be an oxidation reaction if it remove electrons. In other words, the oxidation…
Q: This is the answer key from the teacher and the highlighted parts are the correct answer for the…
A: Enzymology relies on the fundamental idea of Michaelis-Menten kinetics. It covers the interactions…
Q: The steps involved in the T→ R transition in when oxygen binds to hemoglobin are outlined below.…
A: The correct order of the steps involved in the T → R transition in hemoglobin when oxygen binds is…
Q: 14-16. List the group (nonpolar, polar, acidic, or basic) for each of the following armino acids:…
A: Amino acids are broadly grouped into polar and nonpolar. Nonpolar amino acids can be further divided…
Q: Which of the following statements regarding the ends of polysaccharides are true? 1) All…
A: Polysaccharides are polymers of monosaccharides. Multiple monosaccharides get bonded to each other…
Q: biochemistry question, please show all work! As the result of a storm while on a three-hour boat…
A: After a storm leaves you stranded on an uncharted island, you and fellow survivors face a new…
Q: The most immediate result of ATP hydrolysis for the sodium/potassium ATPase is the... binding of ADP…
A: Na,K-ATPase is a membrane protein which plays a vital role in the cell. It pumps Na+ and K+ ions…
Q: Of the steps listed below, which problem would take you the longest to realize you had a problem in…
A: Receptor tyrosine kinases are abbreviated as RTKs.They constitute one class of transmembrane…
Q: What might happen to someone if their cells no longer recognized ghrelin's message? they would never…
A: Ghrelin is a hormone produced mainly by the stomach and, to a lesser extent, by other tissues in the…
Q: Place all eight of these steps of the insulin signaling pathway in the correct order. The…
A: One essential biological mechanism controlling glucose absorption and metabolism is the insulin…
Q: Draw the peptide ASK(ala-ser-lysine) with proper stereochemistry? what is its pI(isoelectric…
A: Given peptide is ASK( alanine- serine- lysine).The peptide is planar due to the partial double bond…
Q: 1. As has been discussed in class the electron transport chain is the first part of oxidative…
A: The electron transport chain (ETC) is a collection of protein complexes found in prokaryotes' plasma…
Q: 3. Now for the citric acid cycle, it is time to follow the carbons! Using labeled pyruvate:…
A: Citric acid cycle is a metabolic pathway that regenerates oxaloacetate from citrate. Acetyl CoA from…
Q: You fill a (fixed volume) dialysis bag with a solution of a protein (1 mM) in water, seal the…
A: Dialysis tubing can be defined as a semi permeable membrane tubing is particularly used in…
Q: Glyceraldehyde 3-phosphate is an intermediate of glycolysis. This molecule was also generated during…
A: During glycolysis, glucose is broken down into two molecules of pyruvate and producing energy in the…
Q: Scientific papers and practical reports must always be written in the first person (I did a PCR, we…
A: Polymerase Chain Reaction or PCR for short, is a scientific method for amplifying DNA…
Q: . List two compounds that can be produced from pyruvate in skeletal muscle b. What are the enzymes…
A: Pyruvate is a three-carbon molecule produced from oxidation of glucose. The process of oxidation of…
Q: 1. Make a Lineweaver-Burk plot and use the plot to complete the information in the table and the…
A: Enzyme kinetics:The study of the reaction rates of enzyme catalyzed reactions. Initial reaction rate…
Q: Which of the following amino acids are aromatic in nature? Select the correct response(s): F [1 H K…
A: The building blocks of proteins are amino acids. They have three groups: an amino group, a carboxyl…
Q: Indicate how the observed Km of an enzyme would change in the presence of inhibitors having the…
A: The Km is known as Michaelis constant, it is the concentration of substrate at which reaction…
Q: Give an overview for the oxidative breakdown of a six-carbon, saturated fatty acid. Decide how the…
A: The 6-carbon fatty acid will undergo two rounds of beta-oxidation to produce three molecules of…
Q: Calculate the change in Gibbs free energy for transport of Ca2+ from outside to inside the cell. The…
A: Free energy change (ΔG) of uncharged solute transport across a biological membrane can be calculated…
Q: 2. Describe how oxygen gas (O₂) is produced during photosynthesis. Include the specific structures…
A: Hi, thank you for your question. Since you have posted multiple questions, we will be answering the…
Q: The thyroid-stimulating hormone thyrotropin has the following sequence: Met-Asp-Tyr-Tyr-Arg Lys…
A: Proteins are folded polypeptides or peptide. A peptide is a short chain of amino acid residues…
Q: Vitamin K questions a) What transformation of glutamate side chains is Vitamin K (as its reduced…
A: Vitamin K is essential for blood clotting. Vitamin K in it's reduced form (Vitamin KH2) is active,…
Q: How many co2 are produced from 1 glucose and 1 c16 fatty acid?
A: During the process of cellular respiration, one glucose molecule breaks down into six carbon dioxide…
Step by step
Solved in 3 steps
- What is the role of his 12 in the RNase-catalyzed hydrolysis of RNA, as indicated in the Figure below? 5' His 119 RNA CH₂ H H 3 O Base 1' 12' 8-H His 12 -P-0-CH₂ a Base H H O -0-P=O H OH NH It acts as a general base, abstracting a proton from the 2' hydroxyl in order to increase its nucleophilicity. It forms an H-bond with his119 in order to stabilize the transition state. It donates a proton to improve the quality of the leaving group. It works through concerted general acid-base catalysis with his119 in order to favour the products of the reaction. Two of the above are true.E. coli ribonuclease H1 is an enzyme that catalyzes the hydrolysis of phosphodiester bonds in RNA. Its proposed mechanism involves a 'carboxylate relay,' as shown below. His124 Asp70 || -HN-CH-C -HN-CH-C- CH2 CH2 c=0 RNA substrate HN H. H. (1) Fill the blanks. In the reaction scheme above, His124 acts as a ( ). The purpose of this relay system is to deprotonate the water molecule (II) so that it becomes a better ( :0Suggest a reasonable strategy for the specific phosphorylation of the5’ –OH group of a nucleoside.
- The enzyme cytidine deaminase catalyzes the conversion of cytidine to uridine. Cytidine deaminase catalyzes the reaction through an addition of water across the cytidine 3,4-bond, forming a tetrahedral intermediate followed by the elimination of NH3 to form the product uridine. This is like the addition-elimination mechanism that we studied for adenosine deaminase. Cytidine deaminase НО. NH₂ N пOH OH cytosine R + H₂O cytidine The Km value for the substrate cytidine is 2.5 × 10-4 M, and the K; for competitive inhibition by the product uridine is 2.5 × 10-³ M. N R A reduced derivative of the product, 3,4,5,6-tetrahydrouridine was shown to be a fully reversible competitive inhibitor with a Ki of 2.4 x 10-7 M, a value approximately 10,000 times lower than that of the product uridine. NH₂ NH uridine HO. N R R = D-ribose HOH OH uridine 3NH uracil ring numbering H NH H H + NH3 H OH H 3,4,5,6-tetra- hydrouridine a.) Draw a structure of the intermediate that we predict to form during the…Given the following diagram of how protein AWESOME1 binds to it's target DNA, describe the potential effects of each of the 5 mutations shown below. The wild-type sequence of a helix #1 is also shown in the blue box, and all the mutations are in helix #1 (see numbers for identifying particular residues). a helix #1 R(1)-V-I-L-Y-F-W-I-M-Y-F-S-H-Y-W-R(16) #1 Predict the consequence of the following mutations: 1) Arg(1) to Glu 2) Arg(1) to Ala 3) Phe(6) to lle 4) Trp(7) to Phe 5) Met(9) to Pro in(c) On the right is a diagram of the ac tive site of E. coli aspartate aminotrans- ferase illustrating the cofactor pyridoxal phosphate (labeled PLP) with the dicar- boxylic acid maleate (labeled MAL) bound in the active site. The structural formula of maleate is shown on the right. Am 194 MAL Arg292 Arg386 Ilx17 Lauf 'coo- H get H Coo- Maleate (c1) Draw the structure of L-aspartate and draw a border around the atoms in the amino acid that maleate simulates. (c2) Identify the active site residues that make hydrogen bonds and electrostatic interac- tions with the oxygen atoms of the carboxylate groups of maleate in the diagram above. Identify the carboxylate groups according to the numbering in the diagram of maleate above. Indicate the hydrogen donor groups of the active site residues. (C3) Compare and draw the structures of L-Arg and L-Lys. On the basis of the diagram why does replacement of an arginine for a lysine have an effect on substrate binding to AspAT? (c4) Of the mutant…
- Treatment of a polypeptide by 2-mercaptoethanol yields two polypeptides that have the following amino acid sequences: Ala-Phe-Cys-Met-Tyr-Cys-Leu-Trp-Cys-Asn Val-Cys-Trp-Val-Ile-Phe-Gly-Cys-Lys Chymotrypsin-catalyzed hydrolysis of the intact polypeptide yields polypeptide fragments with the following amino acid compositions: (Ala, Phe) (Asn, Cys2, Met,Tyr) (Cys, Gly, Lys) (Cys2, Leu,Trp2,Val) (Ile, Phe,Val) Indicate the positions of the disulfide bonds in the original polypeptide. I don't understand how the order of amino acids in Step 2 was arranged. Please explain. Thank you.Consider the following polypeptide sequence: Gly Val Tyr Ile Val Asp His Phe Thr Gly Asn Tyr Ala Leu Met Glu Asp Lys Aps Val Val Ala Tyr Glu His Ala Pro Lys Leu Asp Asp Phe Val Glu Glu Ala Ley Lys Val Glu Ala Gly Glu Val Pro Ala Ala Pro A) List the expected fragments that will result from proteolytic degradation with trypsin. B) List the expected fragments that will result from the reaction with CNBr. C) List the first three amino acids that will be identified by Edman degradation in the fragments generated in B).Treatment of a polypeptide by 2-mercaptoethanol yields two polypeptides that have the following amino acid sequences: Ala-Phe-Cys-Met-Tyr-Cys-Leu-Trp-Cys-Asn Val-Cys-Trp-Val-Ile-Phe-Gly-Cys-Lys Chymotrypsin-catalyzed hydrolysis of the intact polypeptide yields polypeptide fragments with the following amino acid compositions: (Ala, Phe) (Asn, Cys2, Met,Tyr) (Cys, Gly, Lys) (Cys2, Leu,Trp2,Val) (Ile, Phe,Val) Indicate the positions of the disulfide bonds in the original polypeptide.
- Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stopDraw the structure of the dipeptide Gly-His in its fully protonated form. Gly-His Select / Draw C H N Templates O More Erase + 2 QWhich of the following sequences represents a recognition site for N-linked glycosylation where X is any amino acid residue? Gln-X-Ser O His-X-Ser O Arg-X-Ser O Asn-X-Ser O Asp-X-Ser