What is the direction of transcription in the plasmid shown below? Explain your answer based on the features present in the figure.
Q: List the different molecules, an electrons is part of, as it moves from NADPH through the…
A: This is the second phase of photosynthesis , after the light dependent phase. It undertakes CO2…
Q: Question 23 18:1cA9 O w-9 fatty acid O oleic acid
A: Polyunsaturated fats, such as omega-3 fatty acids, are a form of fat that body cannot produce.…
Q: Hormones, such as testosterone, estradiol and progesterone are examples of steroidal lipids. O True…
A: Leydig cells secrets testosterone in male body. In female body ,granulose cells of the ovaries…
Q: one more example of chemical (besides acids and alkalis) which can also affect DNA stability.…
A: DNA can be denatured by process of separating dsDNA into single strands, factors like temperature,…
Q: Which of the following are possible responses to a membrane receptor being activated? O activating…
A: Membrane receptors are protein molecules with specialized functions. Membrane receptors are either…
Q: Question 4 Match the each enzyme deficiency with their corresponding disease B-hexosaminidase A A.…
A: Enzyme deficiency results in certain metabolic disorders and results in serious diseases.
Q: Food Sample marshmallows Pumpkin seeds cracker Dried cranberries рорсorn Rice cake almond
A: Calorific value of foods is based on their nutrient content. Calorific value of foods is the total…
Q: Which of the following glycosidic linkages is hydrolyzed by the a-amylase?
A: α amylase enzyme belongs to the enzyme group of amylase. Amylases hydrolyses the α-1,4-glycosidic…
Q: HO CH, H. CH2 OH I-
A: An amino group and an acid group-containing organic molecules are called Amino acids. when…
Q: Time left 1:48 37 Please describe the digestion process of proteins in the whole digestive system.…
A: In process of digestion, complex molecules are converted to simple molecules with the…
Q: 1. Oils are liquids in room temperature while fats are solid in room temperature. 2. Unsaturated…
A: "Since you have posted a question with subparts we will answer the first 3 questions for you. If you…
Q: The parasite Trypanosoma brucei, which causes sleeping sickness, uses proline as an energy source…
A: A transport mechanism that works to facilitate the movement of substances in and out of the cell…
Q: How does the presence or absence of oxygen influence cell
A: Metabolism is the process of extracting cellular energy from the sources like carbohydrate, amino…
Q: In which of the following citric acid cycle reactions does the coenzyme FAD participate?* citrate -…
A: The citric acid cycle (CAC), also called as the TCA cycle (tricarboxylic acid cycle) or the Krebs…
Q: 1. A farmer crossed a round-shaped (T) and yellow-colored (Y) seed plant carrying yellow seeds (Y)…
A: Dominant allele of a gene expresses phenotype even if it present in single copy. So dominant…
Q: Which of the following contain copper atoms (Cu2*) Select one: O a. Complex II O b. Complex III…
A: There are four enzyme complexes of ETC present in the inner mitochondrial membrane. Complex 1-…
Q: 12. You can distinguish epinephrine hydrotartrate from norepinephrine hydrotartrate by: A. Water…
A: Hi, thanks a lot for submitting the multiple questions. As we are allowed to answer one question at…
Q: 3. Identify if the following is a pyrimidine/purine nucleotide or a pyrimidine/purine nucleoside and…
A: Hi, Thankyou for posting your question on Bartleby. As per the guidelines we are allowed to answer…
Q: Which organ typically does not use fatty acid oxidation as a source of ATP? Liver Brain…
A: Fuel molecules are those biomolecules that upon oxidation yields the body with ATP. Our body uses 4…
Q: The purpose of the carbohydrate in the food industry and its frequency of use
A: A carbohydrate is a biomolecule made up of carbon (C), hydrogen (H), and oxygen (O) atoms, with a…
Q: Explain how energy is invested, stored, and released via chemical reactions
A: Energy is the organism's fundamental requirement. All of an organism's actions require this energy.…
Q: In the Biuret Assay for protein concentration determination, the role of sodium potassium tartrate…
A: The biuret test is a chemical test that can be performed to determine whether an analyte has peptide…
Q: 1. Is the Homo sapiens phenylalanine hydroxylase (PAH) gene encoding a non-coding protein or an…
A: Gene is a portion of the genome that can be transcribed or a functional unit of the genome…
Q: what transport proteins are involved is getting ca2+ out of cytosol
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Is there a possibility that our body is too much of amino acid? If there is, what are the…
A: Introduction: Amino acids are biomolecules that contain an amino and a carboxyl group along with a…
Q: 7. What is the base sequence, specified in the 5' to 3' direction, for a segment of newly formed DNA…
A: The genetic material in most organism is double stranded DNA with the two strands running in…
Q: Given Raffinose, Briefly explain its expected reaction (based on their structural formula) to the…
A: Raffinose is a trisaccharide of glucose, galactose and fructose in which glucose acts as a bridge…
Q: Gold nanoparticles are applied in cancer therapy; approaches such as photothermal therapy as well as…
A: Photothermal therapy is the process of using electro magnetic radiation for treatment of cancer.…
Q: Which of the following products of the non-oxidative stage of PPP is an intermediate in the…
A: PPP : Pentose phosphate pathway The non-oxidative phase of PPP links the glycolysis to the pentose…
Q: 1. DNA replication is described as semi-conservative because A. one leading strand and one lagging…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first 3…
Q: 5. Convert each of the following 3' to 5' DNA sequences to 5' to 3' DNA sequences. a. 3' ATCG 5' b.…
A: DNA contains all the genetic information of an organism in the form of genes. These genes are…
Q: A solution containing 3.58 x 1023 molecules/m3 of protein in water is separated from pure water by a…
A: Introduction: According to Fick's first law, the movement of particles from high to low…
Q: Derivatives of purines and pyrimidines make up the base component of nucleotides. Select the…
A: Purines and pyrimidines are nitrogenous bases that makeup two types of nucleotide bases in DNA and…
Q: When the blood glucose is low, insulin is released from the pancreas to maintain glucose…
A: Insulin is a polypeptide hormone produced by the beta-cells of the islets of Langerhans (of…
Q: Question 1 -- / 1 Where does molecular oxygen (O2) get generated during photo-phosphorylation? 1…
A: The plants use light energy to convert CO2 and H2O into sugars and oxygen. So, photosynthesis is the…
Q: List the microbial targets of disinfecting chemicals, how that affects the microbe, and provide one…
A: The Environmental Protection Agency (EPA) registered disinfecting agents as antimicrobial…
Q: c. (i) Which enzyme in prokaryotes synthesizes the primers? On which strand (leading or lagging…
A: DNA replication, or copying of a cell's DNA, is semiconservative, which means that each strand of…
Q: What is unique about the use of viral gene therapy in cancer immunotherapy
A: Virus have natural ability of delivering genetic material into the cells. Therefore, some of the…
Q: Calculate the standard free-energy change, deltaG'o, for the reaction in which acetaldehyde is…
A: NADH is used as the biological electron carrier and is used for the reduction of Acetaldehyde in…
Q: Consult a biochemistry textbook or handbook: What is the molecular weight of hemoglobin A and S (in…
A: Hemoglobin is a tetrameric protein, which carry oxygen from lungs to the body cells, and carbon…
Q: Tyrosine came from the Greek word "tyros" which means cheese as it was discovered in cheese by…
A: the isoelectric point of an amino acid is the pH at which the net electric charge of that amino acid…
Q: CHALLENGE QUESTION I: Smurf hemoglobin has a p50 of 30 torr and has 8 subunits, instead of the usual…
A: Consider the Protein (P) is getting bound by the Ligand (L) to form the Protein-Ligand complex (PL)…
Q: RI `R? OH
A: DAG is an important lipid it can act as signaling lipid or intermediate in biosynthesis pathway,
Q: 2. By what type of solution can you categorize a solution whose concentration or strength has been…
A: Introduction: Titration is an analytical procedure in which a standard solution is used to find the…
Q: ection steps! Which of the following are proper disir ORemove organic matter O Disinfect only O…
A: Microscopic organisms such as bacteria, fungi (mold and yeast), protists, archaea, algae,…
Q: Describe three important health disorders or diseases related to abnormal cholesterol metabolism
A: Cholesterol is a class of certain organic molecules which is found in the body of living organisms.…
Q: Question 6 Match the following lipids with their functions v Bile acids A. signaling molecules…
A: Lipids are biomolecules that include fats, waxes, oils, hormones, and certain components of…
Q: Which substrate is used in the last step of glycolysis? Group of answer choices Glyceraldehyde…
A:
Q: Explain which of the following substances ATP, CoA-SH, FAD and NAD+ have the subunits in their…
A: Adenosine triphosphate (ATP) serves as the energy currency of the cell while FAD/FADH2, NAD+/NADH,…
Q: The portion (the C-terminal end) of original substrate with the new amino terminus diffuses away.…
A: Introduction: Enzymes have a spectacular ability to accelerate the rate of a chemical reaction.…
What is the direction of transcription in the plasmid shown below? Explain your answer based on the features present in the figure.
Step by step
Solved in 2 steps with 1 images
- Apol (5322) Apal (5258) lacl ApoI (4612) tac promoter pGEX-6P-1-INIA 6347 bp PstI (3301) Ampicillin GST C3 cleavage site Apal (941) Bam HI (946) Pst I (1091) Pst I (1412) inlA funct dom Pst I (1937) NotI (2339)In your own words, explain the term transposon tagging.Consider the following simple regulatory pathways. Assume the full pathway is shown. A- E- B- F- C- G- D- 1 H- A You identify several null mutations (a complete deletion of the gene). For each mutant (ind with a - sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. 2 B 3 C 4 D inducible inducible constitutive uninducible constitutive inducible inducible E uninducible F G H > > >
- The sigma-70 promoter is very well-studied. The Sigma-54 promoter, on the other hand, hasn't had quite as much study devoted to it, but a consensus sequence for Sigma-54 promoters has been determined, and it looks like this: C GAAA FICGCACTECT УА C 5-26-25-24 -23 -22 -21 -20 -19 -18 -17 -16-15-14-13-12-11 -10 3 wablogo berkalay.edu (From Franke et. Al, 2011 BMC Genomics) If you were studying a gene with a promoter that exactly matched the consensus sequence, which base would, if mutated, probably make the largest difference in the ability of Sigma-54 to bind to a promoter? O Base position 26 Base position 10 Base position 12 Base position 16draw the p21 promoter. Your drawing should include (1) the start site, (2) the TATA box and (3) the ERE/AP-1 binding site5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…
- You are attempting to prepare a single gene knockout library using the pRL27 transposon system. You grow the donor E. coli in Luria broth containing both kanamycin and diaminopimelic acid (DAP) and your recipient Serratia rubidaea in plain Luria broth. You combine an equal ratio of donor and recipient cultures and plate the mixture onto Luria agar supplemented with DAP. After 24 hours incubation at 37°C, you create a cell slurry and plate the cells onto Luria agar aupplemented with kanamycin. After 24 hours incubation at 37°C, you find that no colonies grow. What best explains this outcome? A. Failure to supplement media with DAP B. Failure to remove antiobiotic containing media C. Failure to incubate for a sufficient length of time D. Failure to incubate at the appropiate temperature E. Failure to use the proper mating mix ratioAuxotrophic mutation 103 grows on minimal medium supplemented with A, B, or C; mutation 106 grows on medium supplemented with A or C, but not B; and mutation 102 grows only on medium supplemented with C. What is the order of A, B, and C in a biochemical pathway?Consider the gal10D56 reporter gene. In 300 words or fewer, describe 1) the role of GAL7 in galactose metabolism and its importance for cell function 2) the mutation present in the gal10D56 reporter gene 3) the consequence of this mutation for GAL7 expression in wild type cells, 4) the mechanism by which certain mutations can suppress the effects of gal10D56, and 5) the specific purpose for using this reporter gene.
- Are double-knockout animals (DKOs) and even triple-knockoutanimals (TKOs) also possible ?A number of mutations affect the expression of the lac operon in E. coli. The genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene with normal function and "-" indicates a loss-of-function allele.) Please predict which of the following strains would have the highest beta-galactosidase enzyme activity, when grown in the lactose medium. O CAP+ r* p* o* z O CAP* I P* o* z* O CAP* r* P O* z* O CAP I P* O z*Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′