Using RNA interference, it is possible to significantly reduce homologous mRNA transcripts and thereby reduce the expression level of a specific gene of interest. What methods could be used to confirm that an RNAi knockdown experiment has been successful? genome sequencing labeling the RNAi construct western blotting quantitative real-time PCR The relative ease of RNAi studies means that large-scale screens can be performed to assess a wide array of targets. What source would produce the most functional RNAi library for conducting genome-wide screens? microRNAs whole-genome proteins whole-genome DNA whole-genome cDNA
Q: had a response from a peer and this is what they said: You mentioned that aliphatic amino acids…
A: As per the central dogma of molecular biology, DNA contains the code that is necessary for the…
Q: The protein fragments ABS1 and ABS2 of tropomodulin were produced as fusion proteins with chitin…
A: It is possible to filter proteins or fragments of proteins which have been fused with a…
Q: You analyze a protein of 100 kDa using SDS-PAGE in the absence and presence of �-mercaptoethanol…
A: Multisubunit proteins are composed of more than 1 polypeptide chain.SDS (sodium dodecyl sulfate)…
Q: 1. The following reactions can be coupled in the citrate cycle. kJ/mol kJ/mol Succinyl-CoA GDP + Pi.…
A: The Krebs cycle also known as the TCA cycle (tricarboxylic acid cycle) or Citric acid cycle. This…
Q: Write the one letter code for the oligopeptide Ser-Cys-Ile-Glu-Asn-Cys-Glu and calculate the total…
A: On a logarithmic scale from 0 to 14, pH, or "potential of hydrogen," measures the acidity or…
Q: An enzyme catalyzes a reaction with a Km of 9.00 mM and a Vmax of 3.55 mM s¹. Calculate the reaction…
A: Applying the Michaelis-Menten equation, one may utilize the following formula to determine the…
Q: Decide whether each of the following statements is true about ornithine carbamoyltransferase. It's a…
A: Ornithine carbamoyltransferase is an enzyme is important in the urea cycle. Urea cycle is a…
Q: A mutant form of polypeptide hormone has the following amino acid composition: Asp, Arg, lle, Met,…
A: In this biochemical analysis, we will investigate the amino acid composition and sequence of a…
Q: The concept of determining which reactant is limiting and which is in excess is akin to determining…
A: In a chemical reaction, the chemical species react with each other to yield the product(s).These…
Q: Which plot shows the relationship between reaction rate and substrate concentration? O O Reaction…
A: Enzymes are biological catalysts that increase the rate of biochemical reactions.Most enzymes are…
Q: Match the structures and common names of the three fatty acids to their systematic names.…
A: There are four classes of biological macromolecules: proteins, nucleic acids, lipids and…
Q: What is the difference in atp formation in glycolysis and o inactive metabolism
A: Glycolysis is a metabolic pathway that occurs in the cytoplasm of cells. It breaks down one molecule…
Q: Define these aspects of bioenergetics: couple reactions, allosteric enzymes, activation energy
A: Bioenergetics is the field of biochemistry that deals with how cells convert energy, most often…
Q: An enzyme can organize substrates to be nearby in such a way where the local/nearby concentration of…
A: Catatalysis is a phenomenon in which the rate of reaction is altered with the help of a substance…
Q: Which statement about the glycoprotein shown below is true? OH CH₂OH OH HN HN-C O CH3 H₂ Protein CH…
A: Chemically, carbohydrates are polyhydroxy aldehydes or ketones. Monosaccharides are single unit…
Q: different substrate (Substrate 2) with a Km = 30 µM (assuming that both substrates give the same…
A: Given that,Vmax for both substrate 1 and substrate 2 is same (95 μM/sec) and Km for substrate 2 is…
Q: Match the descriptions and compounds with the terms competitive, uncompetitive, and noncompetitive…
A: Enzymes are biological catalysts that increase the rate of biochemical reactions.Most enzymes are…
Q: Name the monosaccharides in the images by placing the appropriate terms. CH₂OH OH OH ОН OH…
A: Carbohydrates are of various types. Based on the number of carbohydrate molecules, it is of 3 types,…
Q: The food industry often uses catalytic hydrogenation to convert double bonds in the fatty acids of…
A: Note:- Sorry, since you have posted multiple. questions, we will be solving the first one for you as…
Q: 1. (a) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to sup- press…
A: An atom's or molecule's electrostatic charge, which can be either positive or negative depending on…
Q: 47. This is NOT true in regards to the functional group of monosaccharides A. It is the carbon…
A: In the realm of biochemistry and carbohydrate chemistry, the properties and behaviors of…
Q: The sigmoidal, cooperative binding curve commonly observed for hemoglobin is a result of: a)…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: The Lineweaver-Burk plot, which illustrates the reciprocal of the reaction rate (1/v) versus the…
A: The enzymes are biological catalysts that increase the rate of biochemical reactions.The enzyme…
Q: The illustration below shows several oxygen-dissociation curves. Assume that curve 3 corresponds to…
A: We know that hemoglobin (Hb) is the protein responsible for carrying O2 in blood. Certain other…
Q: Which of the following is the most efficient enzyme An enzyme with a high kcat and a high Km. An…
A: Enzymes play a fundamental role in biological processes by catalyzing chemical reactions, thereby…
Q: 2. (a) The binding site of 2,3-bisphosphoglycerate (BPG) (red stick figure) in the deoxyhemo- globin…
A: To comprehend the BPG binding site within hemoglobin, it's important to note that it resides within…
Q: For each Acetyl CoA that enters the Krebs Cycle and the products goes through the ETC…
A: The Krebs Cycle, also known as the citric acid cycle, is a crucial component of cellular…
Q: atalyze cleavage of molecules driven by dition of water talyze transfer of functional groups within…
A: An enzyme is usually a protein that increases the rate of the reaction without itself being used up…
Q: In your Amphipathic Home Lab, describe ach of these statements as true or false: Oil and water form…
A: Amphipathic compounds are molecules with both water-attracting (hydrophilic) and water-repelling…
Q: 2. You are in a South American rain forest looking for naturally occuring peptides with potential as…
A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: At pH ___, the pentapeptide AEHVC would contain two positively charged groups and one negatively…
A: Recall that:Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…
Q: Hemoglobin has a pO2 = 100 Ťorr. Low; High High; High High; Low Low; Low binding affinity at pO2 =…
A: Haemoglobin (Hb) is a molecule composed of protein globin and a nonprotein component known as haem…
Q: This is an image of double stranded DNA. Which red label in the above diagram is closest to the 5'…
A: DNA or the Deoxyribonucleic acids serves as the ge immaterial of almost all biological organisms…
Q: 1. Draw the structure of the following peptide: ala-asp-gly-lys-ser-glu-val-arg-his-gly. What would…
A: pKa is the pH at which a weak acid is 50% dissociated. When pH < pKa of the ionising group, the…
Q: Which type of motifs/folds are found in the protein shown below O Colled-coil O EF Hand O Horseshoe…
A: The final products of the expression, "the proteins" attain higher folding confirmation of…
Q: When electrons are removed from a food molecule,the moleculeis conducting anendergonic reaction.…
A: Endergonic reactions are reactions that require an input of energy (heat) to take place. Exergonic…
Q: The graph shows the oxygen-binding curves for myoglobin and hemoglobin. Label the graph and answer…
A: Fractional Saturation (θ) is the fraction of protein molecules saturated with ligands. (since it is…
Q: Write out the mechanism for transimination, the reaction of an amino acid with enzyme-bound PLP to…
A: The transimination reaction, also known as the Schiff base formation,involving the transfer of a…
Q: 2. Chymotrypsin, trypsin, and elastase are members of a family of enzymes referred to as serine…
A: Proteases are enzymes that catalyse the cleavage of peptide bonds. Different proteases employ…
Q: QUESTION 27 If you mixed SDS with the protein below and ran it in SDS-PAGE, how many bands would you…
A: SDS-PAGE or Sodium Dodecylsulphate- Poly Acrylamide Gel Electrophoresis is a molecular technique to…
Q: An enzyme inhibitor that decreases the apparent KM and reduces the Vmax can be classified as an…
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. They contain an…
Q: For each fatty acid: [1] How many molecules of acetyl COA are formed from complete catabolism? [2]…
A: Beta-oxidation is a cyclic process by which fatty acids are broken down into their acetyl-CoA…
Q: The oligosaccharide group on the antibody represented by 1IGT is a monosaccharide residues. O…
A: 1IGT is an antibody with an oligosaccharide group bound to it. The oligosaccharide is responsible…
Q: CO₂ + H₂O H₂CO3→→→→→ H+ + HCO3
A: pH is called as power of hydrogen. Basically, it is the negative logarithm of hydrogen ion…
Q: After completing your analysis of the different bacterial methyltransferases at MethylTranspharmiX,…
A: Enzyme kinetics constitutes the scientific exploration of the intricate mechanisms underlying how…
Q: Which of the following statements about 2,3-bisphosphoglycerate (2,3-BPG) are true? 2,3-BPG lowers…
A: A three-carbon chemical compound called 2,3-bisphosphoglycerate (2,3-BPG) is involved in the…
Q: Substrate concentration, [S], has units of micromolar, µM. Enzyme velocity, V₁, has units of…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: 2. You made a pH=9.8 buffer solution by mixing NaOH and glycine to give a solution that is 0.20 M in…
A: In order to solve (d), first we need to calculate (c). So, here is a brief and comprehensive…
Q: The steps involved in the T→ R transition in when oxygen binds to hemoglobin are outlined below.…
A: The correct order of the steps involved in the T → R transition in hemoglobin when oxygen binds is…
Q: Glucose generally exists in ring (cyclic) form. A Haworth projection shows the orientations of the…
A: Glucose is a monosaccharide and classified as an aldohexose since it contain 6 carbon atoms along…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Describe the primary procedure(key steps no details) that you will follow to clone the C-peptide gene from the RNA above into the only vector you have, a pUC expression vector cut open usingEcoR1which has a 5¢-recognition site and a 3¢- Hind III in the MCS?Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant sickle cell anemia allele of beta globin. This mutation destroys an MstII restriction site normally present in the beta globin gene. This difference between the normal allele and the mutant allele can be detected with Southern blotting. Using a labeled beta globin gene as a probe, what differences would you expect to see for a Southern blot of the normal beta globin gene and the mutant sickle cell gene?Primers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAA
- Genome-wide RNAi screens target expression of > 16,000 genes. Explain how each of these 16,000+ bacterial strains would be engineered in order that they only cause gene silencing of the intended target.Describe the rationale behind the electrophoretic mobility shift assay.1. You are investigating a protein that has the amino acid sequence N ... Ala – Thr - Asn – Trp – Lys - Arg - Gly – Phe – Thr ... C within its primary structure. You found that several of the mutations affecting this protein produced shortened protein molecules that terminated within this region. In one of the mutants, the Asn became the terminal (last) amino acid. (a) What DNA single-base changes(s) would cause the protein to terminate at the Asn residue? (b) What other potential sites do you see in the DNA sequence encoding this protein where mutation of a single base pair would cause premature termination of translation? >
- CA Live Remote Consider the following chart: What type of mutation is this? * DNA: TAC GCA TGG AAT MRNA: AUG CGU ACC UUA Amino acids: Met-Arg-Thr-Leu DNA: TAC GTA TGG AAT MRNA: AUG CAU ACC UUA Amino acids: Met - His - Thr- Leu substitution deletion insertion frameshift mutationFind some unclear points in the "initial transcription by RNA polymerase proceeds through a DNA- scrunching mechanism" paper and rate the overall paper "A(excellent) to D(just fine) based on findings, results, and methods they discussed. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2754788In Northern blot analysis, mRNA samples from tissues are bound to a labeled DNA probe that is complementary to the mRNA, and run on a gel to be visualized. The protein tropomyosin is known to be present in both brain and liver. When brain and liver tissue were assayed for the presence of tropomyosin mature mRNA, bands of two different sizes were seen. Tropomyosin gene diagram (3000 bp total): Shown in attatched image If the band on the Northern blot for mRNA isolated from liver tissue is 2580 bp, whereas from brain tissue the band is 2250 bp, what is most likely? a)The two mRNAs are made from different tropomyosin DNA sequences. b)Exon 2 is alternatively spliced out of the brain mRNA. c)Introns 1 and 2 are spliced out of the brain transcript but not the liver transcript. d)Exons 1 and 3 are spliced out of the brain transcript but not the liver transcript. e)Exon 2 is alternatively spliced out of the liver mRNA.
- An electrophoretic mobility shift assay can be used to study the bindingof proteins to a segment of DNA. In the results shown here, anelectrophoretic mobility shift assay was used to examine the requirementsfor the binding of RNA polymerase II (from eukaryotic cells)to the promoter of a protein-encoding gene. The assembly of generaltranscription factors and RNA polymerase II at the core promoteris described in Chapter 14 (Figure 14.14). In this experiment, thesegment of DNA containing a promoter sequence was 1100 bpin length. The fragment was mixed with various combinations ofproteinsand then subjected to an electrophoretic mobility shift assay.Explain which proteins (TFIID, TFIIB, or RNA polymerase II) areable to bind to this DNA fragment by themselves. Which transcriptionfactors (i.e., TFIID or TFIIB) are needed for the binding ofRNA polymerase II?To determine the reproducibility of mutation fre-quency measurements, you do the following experiment.You inoculate each of 10 cultures with a single E. coli bac-terium, allow the cultures to grow until each contains 106cells, and then measure the number of cells in each culturethat carry a mutation in your gene of interest. You were sosurprised by the initial results that you repeated the experi-ment to confirm them. Both sets of results display the sameextreme variability, as shown in Table Q5–1. Assuming thatthe rate of mutation is constant, why do you suppose thereis so much variation in the frequencies of mutant cells indifferent cultures?Recall that constructs used for floxing a gene contain,within one of the gene’s introns, two loxP sites flanking a gene for neomycin resistance (Fig. 18.11a). AloxP site is only 34 base pairs long, as shown in thefollowing figure.ATAACTTCGTATA ATGTATGC TATACGAAGTTATInverted repeat Spacer Inverted repeatExplain how you could use PCR to generate a neomycin resistance gene flanked by loxP sites, starting witha plasmid containing a neorgene. If you had the intronof the target gene cloned in a plasmid vector, howcould you insert your PCR product into the intron?