Triose phosphate isomerase In a key reaction of glycolysis, dihydroxyacetone phosphate (DHAP) is isomerized into glyceraldehyde 3-phosphate (G3P) by the action of the enzyme triose phosphate isomerase: CH₂OH C=0 CH₂OPO,²- DHAP CHO HC-OH CH₂OPO₂²¹ G3P AG" = +7.5 kJ/mol Because AG is positive, the equilibrium lies to the left. (a) Calculate the equilibrium constant for this reaction, assuming a temperature of 37 °C. (b) In the cell, depletion of G3P makes the reaction proceed. What is the value of AG if the concentration of G3P is kept at 1/100 of the value of the concentration of DHAP?
Q: What effect is seen on a Lineweaver-Burke graph when a non-competitive inhibitor is added to an…
A: The enzymes can be regulated in presence of competitive, uncompetitive and noncompetitive…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA:…
A: During the process of transcription, one strand of the DNA act as the template for the synthesis of…
Q: Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a…
A: DNA is two strands of polynucleotide linked to each other in an antiparallel direction by hydrogen…
Q: Which one of the following features does NOT make HDL a 'good' lipoprotein. It acts as an…
A: High density lipoprotein is the smallest lipoprotein with a size of 5 to 17 nm. It functions to…
Q: Fast please At 20 Celsius degree, protein-Z binds DNA with a free energy of –7 kJ/mole. Protein Z…
A: Free energy: Whether reactants and products will change spontaneously depends on the amount of free…
Q: The AG of the reaction C6H12O6 +602 --> 6CO2 + 6H₂O is -686 kcal/mol glucose The oxidation of…
A: For biological systems, free energy (G), enthalpy (H) and entropy (S) are related as : ∆G = ∆H - T∆S…
Q: Which of the following amino acids would most likely exhibit hydrophobic interaction with…
A: Amino acids containing non polar side chains are called hydrophobic amino acids. These include…
Q: Propose a pathway for the following compound to enter gluconeogenesis / glycolysis. In your pathway,…
A: Glycolysis is a collection of 10 enzymatically catalysed reactions that sequentially oxidise a…
Q: Calculate 1/[S] and 1/V to complete the table. Use this data to draw a Lineweaver-Burke plot, with…
A: A Lineweaver-Burk plot represents the relationship between the reciprocal values of substrate…
Q: In the absence of oxygen is glucose the major source of ATP?
A: It is generally agreed upon that ATP serves as the mediator of energy transfer between anabolism and…
Q: Some enzymes can catalyze a reaction involving NADH but cannot catalyze a reaction that uses NADPH.…
A: Since you have asked multiple questions we will solve the first question for you. If you want any…
Q: Using an arrow, draw the site of cleavage for the following peptides that are reacted by: Pepsin…
A: Amino acids are building blocks of peptides and polypeptide chain. Peptides are consist of 2-50…
Q: . Millions Test Color of Millon's reagent: Sample glutamic acid tyrosine casein albumin gelatin…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: In gluconeogenesis, how is glucose-6-phosphate converted to glucose? is converted to glucose by…
A: Gluconeogenesis is a metabolic process that converts non-carbohydrate carbon substrates such…
Q: If there is ample oxygen available, how many ATP can be produced from complete oxidation of glucose…
A: The aerobic breakdown of nutrients into carbon dioxide, water, and energy occurs during aerobic…
Q: 7. Which of the following statements regarding the regulation of glycogen metabolism is false? A.…
A: In human body, when there is excess of glucose in blood, insulin acts on the hepatocytes and muscle…
Q: The side chain of asparagine contains: OA) a hydroxyl group OB) an amine group OC) a carboxyl group…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: 1a Briefly describe or explain what the term "supercoiling" means in the context of DNA structure.…
A: Supercoiling means the coiling of the coil. Cellular DNA is extremely compacted and implies a high…
Q: Which of the following statements involving the properties of matter (physical or chemical) does NOT…
A: INTRODUCTION : Amylase - It is an enzyme that catalyses the reaction of hydrolysis of starch into…
Q: Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to…
A: Introduction DNA acts as a genetic material in our body. DNA is a double stranded molecule. It is a…
Q: 2. Oxidation of galactose with conc HNO3 yields a. Galactaric acid b. Glucuronic acid c. Saccharic…
A: There are different chemical reactions involving a variety of saccharides or carbohydrates which…
Q: 1.0 E oxygen saturation (Y) 0.6 0.4 0.2 0.0 20 40 60 blood pO₂ (torr) 80 100 120 for this picture…
A: Hemoglobin carries oxygen from the lungs to the tissues and CO2 from the tissues to the lungs. When…
Q: What are the 3 steps of amino acid degradation:
A: Amino acids are biomolecules that act as the building blocks of proteins. Biologically important…
Q: What charged groups are present in lysine at a pH = 7?
A: Amino acids are building blocks of proteins. The alpha carbon of amino acids consist of amine group,…
Q: What is the property/characteristics of DNA that makes it insoluble to ethanol/isopropyl alcohol?
A: The mechanical separation of the nuclear contents from the remainder of the cell, accomplished by…
Q: Which of the following substances can deliver electrons to the ETC to help pump out H+ across the…
A: Electron transport chain is a chain of electron carriers that transfer electrons to molecular…
Q: Since higher concentration colcemid will result in shorter chromosome, you want to change your…
A: It is given that: Molar concentration of the stock solution: 10 ug/ml. Desired dilution…
Q: What is DNA? Provide a 5-sentence long description only.
A: Nucleic acids, large macromolecules are necessary for all organisms and viruses to function. The…
Q: The diagram to the right illustrates the inter-actions of the amino acid side chains of two…
A: Coiled coils are super secondary structures formed as 2 or more alpha helices twist around each…
Q: What effect is seen on a Lineweaver-Burke graph when a competitive inhibitor is added to an…
A: Competitive inhibition is an enzyme inhibition process where an inhibitor molecule (similar to the…
Q: For the tetrapeptide YIRG: a. Draw its complete protonic equilibria. Indicate the net charge of each…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Question 12 of 25 Which of the following are characteristics of animal cells? Select the correct…
A: The somatic cell in animals undergo division by the process of mitosis. The cellular microtubular…
Q: Chemistry Most of the reactions in gluconeogenesis are the simple reversal of the ‘forward’…
A: In gluconeogenesis pathway, the formation of phosphoenolpyruvate from oxaloacetate is catalyzed by…
Q: All enzymes have an optimal temperature and pH environment. Choose how the following changes might…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: ATP stock (50 µM): Make pre-dilutions with 20, 15, 10, 5, 2,5 and 1,25 µM ATP (1000 μL of each)…
A: Molarity is a way of representing the concentration of a solution. Molarity is the number of moles…
Q: Disruption of which process will have the greatest impact on the number of electron carriers used by…
A: Disruption of which process will have the greatest impact on the number of electron carriers used by…
Q: Can you please Draw what this should look like. Chromosome Model Procedure for making a solid wire…
A: Chromosomes The histone proteins H1, H2A, H2B, H3, and H4 assist the DNA to be compressed and…
Q: Although phosphoesters are generally not energetic enough to donate the phosphate to make a high…
A: For an energetically favorable reaction, the change in free energy will be negative, and for an…
Q: vo (μM/min) 25 20 15 10 5 0 7 VO (μM/min) VS pH 8 pH 9.5 10.4
A: Enzymes are the catalysts that function to increase the rate of reaction by decreasing their…
Q: Write the schematic diagram of lodine Value Determination as shown in the video by Amrita Vlab:
A: Simple fats are triglycerides. Triglycerides or triacylglycerols are fatty acid esters of glycerol.…
Q: Which one of the following amino acids is phosphorylated during the process of promoter clearance by…
A: The transcription of genes leading to the synthesis of proteins inside the cells is carried out by…
Q: 1. Glucagon is a hormone that involves in the regulation of carbohydrate homeostasis.…
A: Proteins are made up of amino acid residues linked via a peptide bond. A peptide bond between two…
Q: Discuss how to determine the elements of proteins and its reactions.
A: Proteins are the most abundant biomacromolecule of life. Proteins are primarily polypeptide…
Q: Briefly describe the role of glycoproteins as antigenic determinants for blood groups.
A: Glycoproteins are proteins with carbohydrates attached to it. The carbohydrates that are commonly…
Q: A reaction has a Gibbs free energy change (AG) of +5.3 kcal/mol. Indicate whether each of the…
A: Introduction The Gibbs free energy of a system means the amount of usable energy. The change in…
Q: a. Provide names for both metabolites. b. What kind of reaction occurs here? c. What enzyme…
A: Biochemical reactions are catalyzed by enzymes in which bio-metabolites are transformed into another…
Q: The main stages of catabolism of biomolecules: proteins, carbohydrates and lipids.
A: Catabolism is the degradative pathway. It deals with the breakdown of complex molecules into simpler…
Q: Which of the following statements is CORRECT? A) Hexokinase IV is allosterically inhibited by…
A: Enzyme plays an important role in all the metabolic activities in our body. They themselves remain…
Q: Which of the following statements about oxidative phosphorylation is correct? OH* ions are…
A: Introduction ATP is synthesised in the mitochondria of a cell by a process called oxidative…
Q: 4. Below each item, identify WHAT it is, indicate WHERE in the cell it is used/made (cytoplasm or…
A: Glycolysis is the metabolic pathway that converts glucose into pyruvate. The free energy that is…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- 19. The AG, the standard free-energy change, for the isomerization of dihydroxyacetone phosphate (DHAP) to glyceraldehyde 3-phosphate (GAP) is +7.55 kJ/mol. The reaction shown below is catalyzed by an enzyme called Triose Phosphate Isomerase (TPI). OH O OH DHAP OH TPI OH M+ OH GAP OH This reaction takes place in glycolysis. At equilibrium, the ratio of GAP to DHAP is 0.0475 at 25°C and pH 7.00. Equilibrium constant, Keq = 0.0475. A) Is the above reaction endergonic or exergonic (going from left to right) under the given experimental conditions? Why? B) Can the above reaction occur spontaneously under the given experimental conditions? Why or why not?Consider the following equilibrium at 25ºC :Glucose-1-Phosphate Glucose-6-PhophateUsing the equilibrium concentrations of [Glucose-1-Phosphate] = 0.35 M and [Glucose-6-Phosphate] = 1.65 M, calculate BOTH K′eqand Gº′ for this reaction. Is this reaction exergonicor endergonic? R = 8.314 J/K·molAcetyl CoA + 2H* + 2e = pyruvate + COASH E = -0.48 V Ubiquinone + 2H* + 2e = Ubiquinol E" = +0.04 V Consider the redox rxn wherein a pair of e passes from pyruvate to ubiquinone. Calculate the change in standard Gibbs free energy (kJ/mol). Report answer to two decimal places.
- Standard redox potentials Eo' for some common compounds in biochemistry: Eo' (Volt) + 0,81 +0,42 + 0,25 12 O₂ + 2 H+ + 2 e NO3 + 2 H+ + 2 e 2 cyt c (ox) + 2 e 2 cyt b (ox) + 2 e Pyruvate + 2 H+ + 2 e* NAD + 2 H+ + 2 e Acétoacétate + 2 H+ + 2 e (2) acétoacétate + NADH + H+ H₂O NO₂ + H₂O 2 cyt c (red) 2 cyt b (red) Lactate (3) 2 cyt c (ox) + 2 cyt b (red) NADH + H+ B-hydroxybutyrate + 0,08 - 0,19 With the help of the above table, determine the spontaneous direction of the following reactions in the standard conditions. Justify your answers by calculating the Gibbs (free) energy of reaction in each case. (1) pyruvate + ß-hydroxybutyrate -0,32 - 0,35 lactate + acétoacétate B-hydroxybutyrate + NAD+ 2 cyt c (red) + 2 cyt b (ox)Please provide an explanation for how to work through this practice problem: Using table 12.1, calculate the free energy change for the synthesis of ATP from cAMP and inorganic phosphate. (Note: cAMP is hydolyzed to AMP, and the free engery of hydrolysis for ATP and ADP is approximately equal.) Table 12.1: (Compound: Change in Free Energy in kJ/mol) cAMP: -50.4 Creatine phosphate: -43.3 ATP: -30.5 Glucose 6-phosphate: -13.9 AMP: -9.2Calculate the actual, physiological AG for the reaction Phosphocreatine + ADP = creatine + ATP at 37 °C, as it occurs in the cytosol of neurons, where [phosphocreatine] = 4.7 mM, [creatine] = 1.0 mM, [ADP] = 0.73 mM, and [ATP] = 2.6 mM. Standard Free Energies of Hydrolysis of Some Phosphorylated Compounds Phosphorylated compound AGʻ° (kJ/mol) phosphoenolpyruvate -61.9 phosphocreatine -43.0 ADP (→ AMP + P;) -32.8 ATP (→ ADP + P;) -30.5
- [AktivGrid] Draw the product of the reaction of isocitrate catalyzed by isocitrate dehydrogenase in the TCA (citric acid) cycle. Provide the structure in the protonation state found in physiological conditions. rxn' F-C-H NAD+ isocitra te dehydro genase NADH, Dra H+, > Problem 5 of 12 Submit H Atoms, Bonds and Rings OH Charges CH2OH Drag To Pan CH2OH- H OH Undo Reset ―CH2OH- Remove Done ⚫SH CHO +The ΔG°′ for hydrolytically removing a phosphoryl group from ATP is about twice as large as the ΔG°′ for hydrolytically removing a phosphoryl group from AMP (−14 kJ · mol−1). Explain the discrepancy.Calculate the standard free energy for creatine-phosphate hydrolysis in a cell where [creatine-P]=3 mM, [creatine]=2 mM, and [Pi]= 12.1 mM. Is the reaction exergonic or endogonic?
- Determine the yield in water for the complete oxidation of 1 molecule of a triglyceride containing 3, C16 fatty acids. Please do not show the (7-C)-6 formula. Can you please show me where each water molecule comes from that is considered for this calculation (TCA, ETC, B-oxidation and ATP synthase)? Thank you!ΔG°′ for the isomerization reaction glucose-1-phosphate (G1P) ⇌ glucose-6-phosphate (G6P) is −7.1 kJ · mol−1. Calculate the equilibrium ratio of [G1P] to [G6P] at 25°C.A new drug, Proinebrium, that reduces Kcat (Ki = 2.0 uM) has been developed to treat ethylene glycol poisoning. (1) What concentration of Proinebrium is required to achieve 50% inhibition of ethylene glycol metabolism by alcohol dehydrogenase when the concentraion of ethlyene glycol in the blood is 50 uM?