Snowy owls are large white birds that normally inhabit the cold northern regions of Canada. Recently, scientists and birdwatchers have sighted the snowy owls much farther south than usual. When snowy owls are in northern areas, they feed on lemmings (small rodents). When lemmings are not available, as in the areas further south, the owls will seek out mice or rabbits as their food source. Several snowy owls migrated into an area represented by the food web below founta kel
Q: DNA is alway DNA mRNA 5' aal 3 51 PROMOTER AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC…
A: One of the core concepts of molecular biology is the flow of information from DNA to RNA to…
Q: Explain 3 possible reasons why coral reefs are so diverse?
A: Despite taking up less than 1% of our oceans, coral reefs are one of the planet's most diverse…
Q: How to improve the insulin pump “t:slim”, its effectiveness and transport ?
A: The t:slim X2 insulin pump is a smart gadget that releases insulin into the body automatically. It…
Q: 3. Now consider the following diagram, where two replication bubbles are about to meet. 5 3 Draw in…
A: The lagging strand is the one that starts to open in the 3' to 5' direction toward the replication…
Q: Per alone Fill in with the mRNA strand, then translate to the amino acid sequence #1 DNA: AT…
A: For the vast majority part, creatures retain their genetic information as DNA. Each individual cell…
Q: DNA polymerase error rates can be 10-8 to 10° per nucleotide, and mutations in the repair functions…
A: DNA polymerase is an enzyme responsible for the replication of DNA. It catalyzes the polymerization…
Q: Define the term conjunctivitis and give two examples of what can cause it.
A: Introduction:- Sensory organs are those organs that can sense and detect the change in external…
Q: You are a bacterium which entered the skin through a small cut. Which innate immune defenses might…
A: The instance has been provided here that a bacterium enters the skin through a small cut. Now, both…
Q: Which of the following statements best characterizes genetic diversity in humans? 1.) There are far…
A: Introduction:- Biological diversity is defined as the various different types of life or living…
Q: four main types of tissues on of
A: Tissue: It is defined as the group of cells which are having similar shape and specific function.…
Q: Procedure 1. 2. 3. 4. 5. 6. Fill in the data table below. Complete column B by writing the correct…
A: Process of synthesis of RNA from DNA is known as transcription. As the colum A in the table…
Q: #1 3. Explain how this relationship between the solution and the Elodea cells (from #1) caused what…
A: When compared to the intracellular solute concentration, an isotonic fluid has the same solute…
Q: The formation of _______ during ______ occurs in meiosis, and is different from what occurs in…
A: Tetrad : During the zygotene phase of meiotic prophase, tetrads develop. It is an exclusively…
Q: Signs and symptoms of Asthma in detailed
A: Introduction Your airways may swell, become more constricted, and create more mucus if you have…
Q: (a) Shown below is a schematic of the resulting engineered DNA segment in the plasmid. Fill in the…
A: Lac operon It refers to an operon which are the group of genes with a single promoter - transcribed…
Q: 5. › Polyphenoloxidase is involved in the darkening of wheat products due to its oxidative effect on…
A: Enzymes are biocatalysts which increase the rate of chemical reaction by decreasing the activation…
Q: How we adapt & respond to new environments changes - hint shift away from bio The distinctions…
A: A morphologic, physiologic, or behavioral characteristic of a creature which enables it to coexist…
Q: Synthesis of new bacteriophages in a bacterial host involves the use of a.) Host cell encoded…
A: Phages that only infect bacteria are known as bacteriophages. Phage are available in a wide range of…
Q: In mammals, individuals with two X chromosomes usually de-activate one of the X chromosomes inside…
A: The cell has two kinds of chromosomes. These are sex chromosomes and autosomes. There are two sex…
Q: Indicate the number of nucleotide differences between the virus from Washington and the viruses from…
A: DNA and RNA are called as nucleic acids. The basic difference in the nucleotide sequence of DNA and…
Q: The mitochondrial membrane potential is an indicator of cell viability. Think about mitochondrial…
A: Mitochondria is the energy-generating organelle found in the cytoplasm of the eukaryotic cell. It…
Q: What occurs during food digestion? Energy in large molecules is used to make ATP. Energy from ATP is…
A: Digestive system is the system in our body which help in digestion and absorption of food , it…
Q: http://www.treeboss.net/tree-trunk-splotches.htm downloaded 21 March 2012 Q12. What do you think it…
A: This activity is about different types of living beings which have different characteristics such as…
Q: Use the following information to answer the next five questions. During the summer of 2013 it was…
A: Sickle cell anaemia is an autosomal recessive disorder characterised by abnormal, crescent shaped…
Q: Evolution of Prokaryote into the Eukaryote cell type. A. What are the significant the significant…
A: The major changes that are represented in the evolution of prokaryote cells into eukaryote cells…
Q: Define incidence and prevalence of SARS-CoV-2 infection. Give examples.
A: A new case of SARS-CoV-2 that occurs over a predetermined period of time; typically expressed as a…
Q: Explain how ALS leads to physiological symptoms
A:
Q: The fruit fly Drosophila melanogaster has about 2 x 10^8 base pairs of DNA per haploid genome, of…
A: Drosophila is a fruit fly, which has genetically 4 pairs of chromosomes in its genome. It is the…
Q: Which of the following is part of the extracellular matrix? A) All of the other answers are correct…
A: The fundamental building block of all living things is the cell. The trillions of cells that make up…
Q: how is the rasberry is related to strawberry, banana and grape?
A: The raspberry, strawberry, banana, and grape are the fruits. Their botanical name are Rubus idaeus…
Q: What type of interaction between the base pairs serves as the "glue" to keep the two DNA strands…
A: A chemical bond is a lasting interaction between atoms or ions that enables the formation of…
Q: Which of the following is FALSE in processing DNA sequences using MEGA? Raw DNA sequences must…
A: The Molecular Evolutionary Genetics Analysis(MEGA) is a software that is developed for comparative…
Q: Which of the following could not be used a a host cell receptor for viral entry? a.) LPS on…
A: What is a host cell receptor for viral entry? Each host cell carries specific biomolecules, known as…
Q: which bones are most used for assessing sex in an unknown individual? pelvis humerus…
A: The correct option is: pelvis Due to sexual size and shape dimorphism, the pelvis serves as the most…
Q: 3. Explain the mechanism of liver injury during hepatitis. What role does the immune system play?
A: Hepatitis B (HBV) and C (HCV) viruses are among the seven human hepatitis viruses (A to E, G, and TT…
Q: HQ4. Label the posterior view of the heart.
A: Basis about heart - The heart is the main organ of our circulatory system, It is connected to the…
Q: Porcupines have 34 chromosomes. If a specific porcupine has 5 heterozygous chromosomes, how many…
A: The development of reproductive cells causes various genes to separately separate from one another,…
Q: AL Ataisns AT Aborigins KU KO Kom KU Kurts MA Maral MO Mongols NO No Cent NU NEB AM Amerinds BU…
A: A human mitochondrial DNA (mtDNA) haplogroup is called haplogroup H. Around 20,000 to 25,000 years…
Q: In androgen insensitivity syndromes (AISS), the individual is resistant to the actions of…
A: Androgens are the hormone which play very important role in the male sexual development. AIS is the…
Q: how is the rasberry is related to strawberry, banana and grape in a clade?
A: If fruit is developed from the ovary the fruit is known as the true fruit but sometime some other…
Q: Which of the following genotypes should be considered "true breeding"? 1.) AaBB 2.) AaBb 3.) aaBB…
A: Genotypes It refers to the set of genes possessed by an organism. It describes the variant forms of…
Q: List and explain how to detect adulteration of urine specimens.
A: Disclaimer: - According to BNED guidelines, only the first questions can be answered. Please repost…
Q: The prokaryote cell type is associated with the following structures EXCEPT? a) ribosomes,…
A: The prokaryotic cells are primitive cells which do not have distinct cellular organelles. The…
Q: 20. How many unique gametes could be produced through independent assortment by an individual with…
A: Answer is B ..8 Here from the genotype data Aa, Bb, Dd are heterozygous and CC, EE are homozygous.…
Q: What is the distance between the f and h genes in cM
A: When dealing with such issues, it is crucial to first ascertain the genotypes of the parents. The…
Q: What do you call this part of a phylogenetic tree pointed by the arrow that indicates divergence or…
A: Introduction:- Phylogenetic tree or evolutionary tree is a two dimensional graph which is used to…
Q: 3. In the case of Ashley-X, which of the following was requested from the parents so they could take…
A: Ashley X is an American child with several developmental disabilities because of the static…
Q: What is diabetes type 1 and 2 and why does it occur ? and what is the tole of insulin pump for…
A: Insulin is a hormone, which is secreted by the pancreas which regulate the sugar in the body.
Q: In the cnidaria the ectoderm cells are important because they can react to a stimulus (light) from…
A: Cnidaria possess two layers, endoderm and ectoderm. The gastrodermis, or inner lining, is formed by…
Q: The functions of almost all of the genes in the lambda genome were first explored using mutations.…
A: Lambda is a bacteriophage virus capable of infecting of bacteria. The mature virus particle consists…
Step by step
Solved in 2 steps
- some of the Adélie colonies in this area. Which statement is supported by both the text and the excerpt above? All three penguin species, Chinstrap, Adelie, and Gentoo, live only on sea ice. The food supply for Adelie penguins includes both fish and krill in the Antarctic seas. Adelie penguins are dependent on the existence of sea ice for access to their food supply. Temperatures in the Antarctic have increased substantially in the last 60 years.8th Grade Science STAAR Review Category 4: Organisms and Environment TEKS 8.10B investigate how organisms and populations in an ecosystem depend on and may compete for biotic and abiotic factors such as quantity of light, water, range of temperatures, or soil composition Readiness Standard Baleen whale Smaller loothed whales Sperm whales Penguins Elephant seal Leopard seal Other seals Other birds Fish Carnivorous zooplankton Other herbivorous zooplankton Krill Phytoplankton 1. Which 3 organisms are in competition for carnivorous zooplankton? 2. How will the leopard seal population be affected if the penguin population declined? 3. Which would be more affected by a decrease in the krill population -"other seals" or "other birds"? Why? 4. Name 3 abiotic factors that the organisms in the food web above would compete for.Please do answers 4-7 these are the answers for the above : 1) Producers Consumers Herbivores Omnivores Predators Top predators Phytoplanktons, seaweeds All the other animals other than Phytoplanktons, seaweeds are consumers. Zooplankton, Starfish, Mussel Right whale Squids, Antarctic toothfish, Adelie Penguins, Weddell seal, Crabeater seal, Emperor penguins, Octopus, Krills, Borch Killer whales, Leopard seals, Albatross, Sperm whale, Humpback whale, Antarctic fulmar 2. The original energy comes from the sun. The plants/producers convert light energy into chemical energy. 3. The longest food chain is - Phytoplankton - Zooplankton - Krill - Squid - Crabeater Seal - Killer whale
- After completing the GVL OER module - Population Dynamics, explain the relationship between predator and prey. Identify the patterns that exist in the dynamic relationships between predator and prey. Relate your discussion to the overall health of their populations and ultimately the ecosystem. How does each organism benefit from the other? In what ways do other populations in the ecosystem benefit?Case Study Skolnikland is in Eastern Africa, with a population of 30 million people. The country has a plains region, a hill region, and a region with high mountains. It has a number of ecosystems. The plains are dry for much of the year, there is some rainforest, and the rest of the country includes both hills and mountains. There are two seasons of heavy rainfall. The citizens come from several ethnic groups that tend to live in their own regions and speak different languages. The ethnic groups largely follow one of three different religions. The large cities are mixed ethnically. One ethnic group is economically and socially very dominant. The people from this group live in the capital and most of the large cities. The national language is the language of this dominant ethnic group. According to World Bank criteria, Skolnikland is among the poorest countries in the world. The economy has been growing at about 4% per year on average over the last decade, but the economy had very slow…Subject: Environmental Science Design a food web for the human. (it should be more than 10 species)
- Science-SC5 x + e r19.core.learn.edgenuity.com/Player/ ental Science - SC5181 A 2 Unmark us question C 6 5 ↑ Which of the following is a reason humans commonly might become ill from waterway eutrophication? O Dairy products might be contaminated with excess oxygen. O Fish absorb high levels of phosphorus that are passed on to humans. O Drinking water can become contaminated. O The gasses released from algae blooms may cause respiratory distress. 7 6 8 M Oll E33 800 CRO DELL & O ▶ * ▶ O Save and Exit Next 4 < ★ English V 10 * Submit L LOX ⠀ Kinley Heath + Oct 7 2:05 0Part B- How does this research relate to your bialogy course? Biomes are major life zones characterized by vegetation and climate, primanily average temperature and precipitation Sort each characteristic to align with the appropriate biome. Hint: Review terrestrial biome information in your textbook or e Text. Greatest human impact is logging and land clearing for agriculture and urban development Large variation in annual preoipitation but with high annual temperatures Located along or near the equator Located at high latitudes in the northern hemisphere Greatest human impact is rapid population growth leading to habitat destruction Greatest human impact is destruction of forests through logging Significant precipitation throughout the four seasons Located at midlatitudes, mostly in the northem hemisphere Relatively low annual temperatures Tropical forest Temperate broadleaf forest Northern coniferous forestPART A: Fishing for the Future Review the Tragedy of the Commons: https://youtu.be/CxC161GvMPc Additional resources for this laboratory exercise: Seafood Watch: http://www.seafoodwatch.org/ Center for Marine Conservation Ocean Action Network: www.cmc-ocean.org Marine Fish Conservation Network: www.conservefish.org World Wildlife Fund Conservation Action Network: www.takeaction.worldwildlife.org UN FAO Fisheries and Aquaculture Department: www.fao.org/fishery/en Marine Stewardship Council: www.msc.org/ 1 Why is conservation important? 2 Do a search online. What can you do to help protect the oceans?
- com/forms/d/e/1 FAIPQL Hawk Ocelot Flycatcher bird Squirrel Caterpillar Iguana Grasshopper Plant materials, leaves, fruits, seeds Figure 4. Terrestrial food web a. Idenrifv. from the food web shown in Figurea food chain ich FOUR trophic lev els. Your answer KO Nentify. from the food web in Figure 4 ONE predator and ONE organism which is likelv to he its prev dpWrite Thesis Statement on any one of the following topics: step 2 a. Global Warming and its impacts on Bio-diversity OR b. E-Commerce and its impact on our livesAll changes saved 13. Which of the following are the three important questions that should be considered when explaining human-environment interaction? Select all that apply. a. What is the difference between ecosystems and biomes? b. Why do people change their environment? c. How do people modify the environment? d. How do people adapt to the environment? ☐e. How do people depend on the environment?