6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA?
Q: Which of the following has a triple helix structure? α-keratin. Collagen. Amyloid.…
A: A triple helix is three chains of molecules that are intertwined around a common axis. For…
Q: Which of the following regulatory sequence allows transcription to continue? a) Sequence 4 b)…
A: Sequence 4 is likely referring to the terminator sequence in the transcription unit. In bacteria,…
Q: What is the chemical basis of rancidity? How can it be prevented?
A: Introduction: The given answer explains the chemical basis of rancidity and the ways to prevent it.…
Q: A researcher is following an immunohistochemistry protocol. Before blocking the tissue section, the…
A: Immunohistochemistry is a method which can be used to detect antigens present in a tissue sample by…
Q: a) How much more O2 can be transported by the blood when erythrocytes leave the lungs? Consider that…
A: Myoglobin and Hemoglobin are both oxygen binding protein. Myoglobin is made up of a single…
Q: Protein Solubility pll 3.5 4.5 6.5 7.5 Dilution Factor 5 5 50 50 Absorbance 0.098 0.027 0.028 0.032…
A: Protein solubility is defined as the concentration of protein in a saturated solution that is in…
Q: The coenzyme NADP is the terminal electron acceptor in chloroplasts, according to the reaction 2 H₂O…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: Can you draw the steps, metabolic intermediates, and by-products of glycolysis and the TCA cycle
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: • What is the mechanism of action of epinephrine, including its signaling mechanism(s), second…
A: First, the cell spends the ATP reserves. Increased cellular concentration of ADP triggers oxidation…
Q: Formula for % solubility of proteins: % solubility = [(C x V x F) / (1000 x 35%)] x 100% C =…
A: Percent solubility is a measure of the substance's ability to dissolve in solvent. It is the maximum…
Q: Which of the following statements is true about biomembrane? Membrane proteins and lipids are…
A: Cell membranes, also known as plasma membranes, are thin, flexible barriers that surround the cell…
Q: Which of the following histones shows more sequence similarity among eukaryotic species? a) H2A b)…
A: Histones are highly conserved proteins that play a crucial role in packaging DNA into chromatin.…
Q: Glucose 6-phosphate can be used for other purposes apart from energy production_ Which of the…
A: Once inside the cell, glucose is phosphorylated by hexokinase to prevent it from leaving the cell.…
Q: In diabetes mellitus the activation of fatty acid oxidation causes ketosis. What disorder of…
A: The above answer explains how the activation of fatty acid oxidation in diabetes mellitus can lead…
Q: Which of the following is an example of RNA-dependent DNA polymerase? a) RNA polymerase II b) DNA…
A: DNA polymerase is an enzyme that catalyzes the synthesis of new DNA strands during DNA replication.…
Q: 5. Genetics & Gene Control A. Explain the difference between a DNA strand, a chromosome and a gene.
A: Hi! The question 4 is incomplete as the information of problem 3 is not provided in the present…
Q: In the replication of the E. coli chromosome, about how many Okazaki fragments would be formed?…
A: Prokaryotes have evolved to contain simple genomes. Thus, they are more efficient in replicating…
Q: A(n)___________ reaction converts glycerol to dihydroxyacetone. This reaction requires _________ and…
A: Glycerol is a simple molecule that can be converted into several important intermediates in various…
Q: Find Kcat value =slope From the graph attached
A: Kcat or turnover number says us about the maximal number of substrate molecules that are transformed…
Q: The limit for G-200 beads is 5000-600,000. When you pass two proteins- Protein A (75, 000), Protein…
A: The concept here relates to the use of gel filtration chromatography, which is a type of size…
Q: Draw a schematic illustration of the hydrolysis of N-acetylphenylalaninamide catalyzed by…
A: Alpha-chymotrypsin is a protease enzyme that hydrolysis peptide bonds to produce small peptides and…
Q: Transamination and its significance.
A: Transamination is a fundamental biochemical process that plays a critical role in the metabolism of…
Q: 17. Mutation can be caused by the alternative base pairing that arise due to tautomerization and…
A: Base pairing is a fundamental concept in the structure and function of DNA. The four nitrogenous…
Q: Write briefly about triglycerides.
A: Introduction: This answer provides a detailed explanation of triglycerides, a type of lipid molecule…
Q: 9. Sulphur containing amino acid is (A) Methionine (B) Leucine (C) Valine (D) Asparagine
A: The above answer explains why Methionine is the correct answer to the question "Sulphur containing…
Q: 3. In this question you can do the graphs on your computer. A, Calculate the Vmax and Km in the…
A: Enzyme catalysed reactions follow Michaelis Menton equation which is : Vo=VmaxSKm + [S] Here, Vo is…
Q: 14. The monosaccharide units are linked by 1→ 4 glycosidic linkage in (A) Maltese (B) Sucrose (C)…
A: Carbohydrates are sugar molecules. Saccharides are another name for sugars. Monomer units are single…
Q: Explain about Cytochrome P450 in detoxification.
A: Cytochrome P450 (CYP) is a group of enzymes that plays a crucial role in the metabolism of…
Q: A biologist investigating enzyme function plotted the activity of a particular enzyme (y-axis) vs pH…
A: Enzymes are biological catalysts that increases the rate of biochemical reactions. Enzymes are…
Q: In E. coli, oxidation-reduction reactions (or ATP hydrolysis) within the cell membrane generates a…
A: The Gibbs free energy change (ΔG) associated with the proton motive force can be calculated using…
Q: Question: A. To explore the consequences of coupling ATP hydrolysis under physiological conditions…
A: The Gibbs free energy change of a reaction is given by ∆G=∆G°+RTlnQ where, ∆G=Gibbs free energy…
Q: 12. Explain about Green House effect.
A: In this answer, I will explain the greenhouse effect, a natural process that occurs when certain…
Q: Which of the following is not involved in the post-transcriptional processing of t-RNA? a)…
A: a) Attachment of poly-A tail: Poly-A tails are typically added to the 3' end of eukaryotic mRNA…
Q: What are prostaglandins? Name them. Write their functions.
A: Introduction: Prostaglandins are a group of lipid molecules derived from fatty acids that have…
Q: Describe ATP/ADP recycle in humans?
A: Adenosine triphosphate (ATP) is the energy currency of cells. It is used for various cellular…
Q: Is there anyway to draw a visual diagram for this as the explanation does not make sense how can 2…
A: The catalytic triad is a group of three amino acids that are commonly found in the active sites of…
Q: Glucose-6-phosphate dehydrogenase catalyzes the first step of the pentose phosphate pathway. This…
A: Km of an enzyme is the measure which gives an idea of a substrate's affinity towards its enzyme. It…
Q: 2. A DRUG WHICH PREVENTS URIC ACID SYNTHESIS BY INHIBITING THE ENZYME XANTHINE OXIDASE IS (A)…
A: The answer to the question of which drug prevents uric acid synthesis by inhibiting the enzyme…
Q: Passive transport across the membrane mediated by a carrier— would not be saturated by…
A: Membrane transport refers to the movement of ions, molecules, and other substances across the cell…
Q: sketch a phosphodiester bond
A: A phosphodiester bond is formed when two of the hydroxyl groups of phosphoric acid undergoes…
Q: Which position of a codon is said to wobble? a) Fourth b) First c) Second d) Third
A: The genetic code is a set of rules for translating the nucleotide sequence of RNA into the amino…
Q: 4. Describe the detoxication of ammonia by urea cycle. Explain its regulation and disorders.
A: Ammonia is a toxic waste product that is generated during the metabolism of nitrogen-containing…
Q: Macmillan Learning You are characterizing a new DNA polymerase. When you incubate the enzyme with…
A: All DNA polymerases have the 5'→3' polymerase activity which enables the DNA polymerase to extend…
Q: Which of the following statements best explains why the activity of ATP-citrate lyase and malic…
A: ATP-citrate lyase (ACL) and malic enzyme (ME) are enzymes involved in cellular metabolism. ACL is…
Q: 64. The fatty acid present in cerebrosides is (A) Lignoceric acid (B) Valeric acid (C) Caprylic acid…
A: The answer to the question "What is the fatty acid present in cerebrosides?" is (A) Lignoceric acid.…
Q: Directions: Explore PDB Statistics using the data tables and answer the following questions: 1.…
A: RCSB-PDB stands for Research Collaboratory for Structural Bioinformatics-Protein Data Bank. This…
Q: Using the table below, which of the following dietary lipids has the greatest percentage of…
A: Conceptual Introduction Dietary lipids play an essential role in providing energy, storing…
Q: 11. Proteins contain (A) Only L- a - amino acids (B) Only D-amino acids (C) DL-Amino acids (D) Both…
A: Proteins are essential molecules that play a wide range of roles in living organisms, from providing…
Q: I can select only one false option you are mentioning 2 false questions please pick one
A: The free energy released from oxidation of glucose to carbon-dioxide is stored in the form of…
Q: What principles define large polysaccharides, proteins, and nucleic acids?
A: Polysaccharides are large molecules formed by carbohydrates. Proteins are large molecules formed by…
Step by step
Solved in 3 steps with 3 images
- Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.6. A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCTGCTGACGCTGCTCGTCG-3' 3'-TACTAAGCGGAGCCCCGAGGGGTCAGCGACCACGACGACTGCGACGAGCAGC-5' The sequence of the mRNA transcribed from this gene has the following sequence: 5'-AUGAUUCGCCUCGGGGCUCCCCAGUCGCUGGUGCUGCUGACGCUGCUCGUCG-3′ a. Identify the coding and noncoding strands of the DNA. b. Explain why only the coding strands of DNA are commonly published in databanks.II. Use the eukaryotic gene DNA sequence below to answer the following questions: 1 11 21 CGACTTACTG 51 TGGACGCGCC 101 61 GGCGTATAAA GCGACGACTG TAGACTGATG AGCCTATCCA 111 71 121 31 ATGGCCCTGT AAGCGGTGCG ATGCAATAAA ACGCGTATCA 81 Polyadenylation signal in the corresponding mRNA: Kozak's sequence in the corresponding mRNA: Start (initiation) codon in the corresponding mRNA: Stop (termination) codon in the corresponding mRNA: 61-69 c. Where is the 3' UTR? Circle one. 70-111 14-60 131 41 GTCATTCAGC GTAGTCTGAT GCCAGTCGAC TGCATTGGAC ACCGGTTACA 91 a. Write the corresponding sequences, circle & label them in the sequence above: TATA box sequence: (label as TATA) 37-45 73-90 141 (label as poly-A) b. What region of mRNA contains the open reading frame that will be translated into protein? Circle one. 51-111 (label as Kozak) (label as start) (label as stop) 71-81 85-150
- 6. Indicate whether each of the following events occurs when tryptophan is high or when tryptophan is low by placing a check in each of the appropriate blanks. Share your reasoning. Tryptophan Tryp high Event Ribosome does not stall at Trp codons Region 2 of the leader pairs with region 3 Ribosome covers part of region 2 of leader Transcription is terminated before structural genes are transcribed2. Shown below is the DNA sequence of a eukaryotic gene that encodes a short peptide. The sequence of the final processed mRNA synthesized from this gene is given below. Genomic DNA sequence: 5'-AGCTCATGTGCGAGTCCTGACGCTGACTAGG-3' 3'-TCGAGTACACGCTCAGGACTGCGACTGATCC-5' Processed mRNA sequence: 5'-G*UCAUGUGCGAACGCUGACUAGGAAAAAAAA....-3' In the genomic DNA sequence shown above, draw a box around each of the two exons in the gene or write the two exon sequences. а. b. In the processed mRNA above, some nucleotides are present that are not coded for in the genomic DNA sequence. Name the two processes that have occurred to add these nucleotides to the mRNA.1. A DNA base sequence transcribed into messenger RNA in the following sequence: TTATCTTCGGGAGAGAAAACA. a. If you read from left to right, what amino acids are coded by this sequence? (Note: The initiation sequence is disregarded in this example.) b. If proflavine treatment caused the deletion of the first adenine nucleotide on the left, describe the changes that would occur in the first six amino acids coded by this sequence?
- 6. Examine the following coding strand DNA nucleotide sequence,^representing the complete gene sequence (i.e. control elements + RNA-coding sequence) of a bacterial gene. Answer the questions below by using the list of consensus sequences and the genetic code. 5' CGCTCAGAAAATTATATTAAATTTCCTCTTGACACTCGCTTTCGTGATCGTCTTATAATGTGTGGATG CCGAAAACGACAATTTCTGACTTACCGGGGTTTTAAGGAGGTAATATGCAAATTAGCGATACCGGCC GCAGCCACACTCCTGACTTTCACGCCTAGTCGCCCGTGAAGACTGGCACAACCAGACCATTACCCACC TTAACCGCCTGCCAGCGCATCCCGTTTTCGCCAGCTGGCGCGATGAGCTTGCCGCCCGCGATTCAGCC CGCGTAGTAAGCGGGCTTTTTTTGGGAGTGGCAGTTCTCTTACGCCCGCAGCCCG 3' Clearly indicate the following directly on the DNA sequence above: promoter elements - underline and label as (a). the sites for initiation of transcription - use an arrow V and label as (b). the sites for termination of transcription – use an V arrow and label as (c). d. Give the sequence of the first 10 nucleotides of the mRNA transcript 5' to 3'. a. b. С.2. a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the direction (5' and 3') of the two DNA strands. +1 -10 -35 3'тTGCATССGAAАCGTACGATCGATCGGCCGACTТАТТАСGАТСGGACTAфTGCGTCсTAGC5'... ...5'AACGTAGGCTTTGCATGCTAGCTAGCCGGCTGAATAATGCTAGCCTGATGACGCAGCATCG3'... (i) Write the first 12 nucleotides of the RNA molecule transcribed from this gene. Be sure to indicate the 5' and 3' ends from left to right of the RNA strand. (ii) Explain why the Start codon does not appear in the first three nucleotides of the sequence transcribed in (i).1. Create a DNA sequence with eighteen nucleotides. Indicate its 3’ on the left and 5’ on the right since that’s the template strand you will need in the next question to transcribe the mRNA. 2. Transcribe the DNA sequence above and separate the triplets into codons. Indicate 5’ and 3’ in the correct location on the strand. (Don’t worry about splicing- assume that the pre- mRNA is the same as the mature mRNA sequence) 3. Look at the genetic code, and indicate which amino acid is coded for by the codons in the above mRNA. 4. ANSWER BELOW QUESTIONS: A. First write the original DNA strand. Indicate where the substitution was by either circling it or writing it in a different color. Then write the mutated DNA sequence with the point mutation (aka substitution) wherever you choose for it to be. Again, circle it or write it in a different color. Do the same for the transcribed mRNA. Repeat the directions for 2 and 3 for this new DNA stand. (i.e., include the mRNA and translated protein…
- 2. Given a DNA template molecule of 5' - ATGGCTCCTACCTACTAGTTAACATATGG-3', generate the mRNA sequence and then the polypeptide sequence, starting at the first start codon. mRNA: 5'- CCAU AUG UUA ACU AGU AGG UAG GAG CCA U - 3' Polypeptide: (N) Met-Leu - Thr - Ser - Arg (C)1. Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds from left to right. 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGACCTAAGC -3' 56 1 11 + ---+--- ----+-- * a. Draw a green box around the promoter. b. Label the template strand of the DNA on the sequence above. C. Write the sequence of the mRNA. Anticodon sequence: --+--- 3'-GGCTATATTACTCAGCAGCAGACCCGGAAGTACATAAGTACCCTTCTCTGGATTCG ---+-- -5' d. Write the sequence of the peptide that is translated from the mature mRNA and label the directionality of the peptide. e. Give the sequence (and indicate the directionality) of the anti-codon on the tRNA that inserts the 2nd amino acid into the newly made peptide. f. Imagine that, in the process of DNA replication, the 39th base in the gene (with the *) was changed from A/T to C/G. What would be the effect of this mutation on the produced peptide?3. Transcribe the following DNA sequences into their corresponding mRNA. (Hint: be sure to pay attention to the 5' and 3' ends!) 3' GGCTTATACGGGCCAAACGTGCATATTGC 5' a) Gene: Matching mRNA 5' 5' TGAACATGGGCAGGTTGACTCGGATCATG 3' b) Gene: Matching mRNA 5' 3' 3'