Refer to the Table of the Genetic Code and match the type of mutation to the following codon changes
Q: chemicals being applied for the leafy vegetables to produce seeds? If yes,
A: In today's world , almost all grown vegetables are being sprayed with pesticides, fungicides and…
Q: CH,0-P-O C=0 0. CH;0-P-O CH,OH HO-C-H H-C-OH C-H Ö HO--H ČH,O-P-O- H-C-OH O t. CH;0-P-O
A: Glycolysis is a metabolic pathway of conversion to glucose to pyruvate.
Q: Retroviral delivery of the gene coding for Combined Immunodeficiency. treats individuals with Severe…
A: Successful gene therapy that is performed with the retroviral vectors neceserily requires robust…
Q: What is tne value of VX P in tne Table 6? Table 6. Data on Volume-Pressure Relationship Trial volume…
A: Answer- The value of V*P is given below- Trial Volume (L) Pressure (atm)…
Q: Proteomic analysis by mass spectrometry involves digestion of samples with to generate peptide…
A: Tandem mass spectrometry is a major technique for the peptide/protein sequencing and PTM analysis.
Q: Carbon monoxide is lethal at low concentrations yet it plays an important role in cell signalling…
A: During the breakdown of heme, carbon monoxide (CO) is continually created in mammalian cells. CO is…
Q: As listed in the LIPID MAPS Structure database, a synonym for 18:2w-3 using the (n-x) nomenclature…
A: LIPID MAPS computationally-generated database of "bulk" lipids.
Q: . Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…
A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…
Q: Group I and II introns are present in the following classes of RNAS. MRNAS O miRNAS SİRNAS TRNAS
A: Mobile introns are defined as the intervening sequences. These sequences are the ones that are…
Q: Fill out the following table:
A: Molecular biology is a field of biology which deals with studying the composition and interactions…
Q: Using specific examples, compare and contrast G-protein coupled receptors and nuclear receptors with…
A: The binding of signaling molecules to specific receptors and production of a cellular response…
Q: Morphine (give structure) and enkephelin (give structure) both are antagonists of the m opioid…
A: An antagonist is a particular drug that blocks opioids by attaching to the specific opioid receptors…
Q: sunganegy Two dialysis membranes each containing a methylene blue solution were placed in beakers of…
A: In dialysis, colloids are separated from dissolved ions or molecules of small dimensions or…
Q: 12 If strong-base anion exchange resin is applied to treat raw water with silicate, the pH of raw…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: 1. The following lipids are important structural components of the cell membrane of fish. Draw the…
A: The membrane phospholipids have a glycerol backbone.
Q: Yeast fermentation is of a value in making baked products due to the release of: Select one: O a.…
A: Fermentation occurs in the yeast in anaerobic conditions. Alcoholic fermentation occurs in the…
Q: For carbohydrates to be converted to energy, it undergoes the process of metabolism, where in the…
A: Carbohydrates are major energy source of human beings. It is most important component of our diet .…
Q: Determine the number of carbon atoms present and the the total number of phosphate groups present in…
A: In our body, many metabolic pathways occur. In these pathways, Glycolysis also occurs to convert…
Q: Explain the correlation between fasting and gluconeogenesis in terms of the hormone released by the…
A: Gluconeogenesis is the process of Synthesis of glucose from non Carbohydrate sources like…
Q: Classify the following amino acids base on their side chain if it's either -Non-polar aliphatic R…
A: Amino acids are the molecules that contain an amino group and a carboxylic group linked through the…
Q: A biological Claisen reaction occurs in the conversion of two acetyl CoA molecules to one…
A: Introduction: The condensation reactions involve the formation of new carbon-carbon bonds. The most…
Q: The concentration of your RNA solution is 1500 ng/μl. How much RNA solution do you need to use when…
A: The concentration of RNA in solution can be determined by measuring absorbance at 360 nm.
Q: Which of the following genes have internal promoter elements? 5S FRNA MRNA snRNA None of the above
A: Promoter : the sequence that are important in the initiation of transcription of a transcription…
Q: Enhancer sequences may be very far from the genes they affect but they are always upstream of the…
A: Enhancer sequence : These are regulatory DNA sequences, when these are bound by transcription…
Q: J A positive result for Fohl's test is the formation of a black precipitate in the form of lead. O A…
A: Fohl's Tests - This test is performed to detect the presence of amino acid which containing sulfur.…
Q: e. 92 sister chromatids
A: In eukaryotes, two types of cell division partition the genetic material into progeny or daughter…
Q: How many chromosomes are there in a body cell of a person with trisomy 21 condition? Select one: О…
A: Trisomy 21 is a genetic chromosomal disorder . Genetic chromosomal disorders are the diesese occurs…
Q: Which of the following viruses have been used as vectors for gene delivery?
A: Gene delivery is a process of introducing the foreign genetic materials which are DNA and RNA into…
Q: (a) Draw the condensed structural formula, and give the name and abbreviation for the dipeptide…
A: Dipeptide is the structure formed by two aminoacids with a single Peptide bond. Anomeric carbon is…
Q: In which type of segregation, genetic information is gained? Alternate Adjacent Both None
A: Principle of Segregation genes explains how pairs of gene variants are separated into reproductive…
Q: 4 types of color coding in biomedical and health care waste management
A: Health care waste is all the waste produced by a medical institution, a medical research facility,…
Q: Which of the following are responsible for removing introns from RNAS in eukaryotes? Major…
A: RNA splicing : It removes the interrupting, non-coding sequences of the genes (introns) from…
Q: On the right the Hill plot com- (b) pares the O2 binding properties of Hb Ya- kima with those of HbA…
A: The Hill plot given in the diagram shows the allosteric regulation and affinity of the different…
Q: 4. Enzymes in an enzymatic reaction do not interfere with: a. free energy of reaction b. rate of…
A: Enzymes are the biological catalysts that speed up the rate of reaction by lowering the activation…
Q: Consider 41 NADH and 19 FADH, molecules funneling electrons into the electron transport chain…
A: Oxidative phosphorylation is the end point of energy-yielding metabolism in aerobic organisms. It…
Q: rue or False? a. Ribose and deoxyribose are formed from glucose.
A: Ribose is a pentose sugar with molecular formula C₅H₁₀O₅, it is the prime component of…
Q: True or False? a. An excess of amino acids can result to the destruction of proteins.
A: The destruction of proteins in cells can occur when due to misfolding and aggregation of proteins…
Q: topic: sds-page gel If APS is not available, what other chemicals can be used alternatively to…
A: APS stands for Ammonium Persulfate. It is an oxidizing agent that is used along with TEMED in order…
Q: DNA Leading strand: 5' AAA ATA | CGC TTT|TTA ATT| AAC CCC GGG 3' A | B| C I D Exons: A, C, D…
A: The Central Dogma of Molecular Biology states that the genetic information stored in DNA is first…
Q: . Using electron flow arrows, show electron transfer from nadh to fmn in complex 1 of the electron…
A: The electron transport (ETC) chain is coupled with ATP synthesis. ETC occurs in Cristea…
Q: calculate the net charge of your peptide at I) pH 2.0; ii) pH 6.0 iii) pH 7.0; iv) pH 11.5. show…
A: Amino acids contain ionizable groups, the ionic form of the amino acids depends on the pH. The…
Q: gel electrophoresis
A: Gel Electrophoresis is a simple , rapid and analytical technique which is used for separating the…
Q: Reactions and Thermodynamics of Glycolysis
A: Third step of glycolysis, fructose-6-phosphate is converted to fructose- 1,6-bisphosphate by…
Q: Starting with a 4-carbon growing fatty acid attached to the ketoacyl synthase (KSase) site, and a…
A: Fatty acid metabolism includes Fatty acid biosynthesis (an anabolic process) and β-…
Q: 1. A student, halfan hour after the dinner, containing about 150 g of carbohydrates, 20 g of fat,…
A: Hi! Thank you for the question. We are authorized to answer one question at a time, since you have…
Q: Water Activity
A: Given above graph is bell shaped graph which shows Water Activity Stability Diagram which is in the…
Q: Which of the following statements are correct? Explain your answers.A. An atomic nucleus contains…
A: Since the atom and nucleus were discovered. The bonding of a proton and a neutron, a proton and a…
Q: 4. As stated in your textbook, the first two reactions in glycolysis associated with unfavorable AG"…
A: The 2 reactions of concern here are the 6th and 9th reactions of glycolysis. Both these reactions…
Q: Describe surroundings at home which reminds you about biochemistry and relate the situation to…
A: Food is the source of macronutrients and micronutrients required for the body. During the process of…
Q: 1.Antibiotics that are active against G= and G- organisms such as Blank 1, Blank 2, and Blank 3…
A: Hi! Thank you for the question. We are authorized to answer two subparts at a time, since you have…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTTBased on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: 5’ ATG GCT AGA GTC GAG TTG 3’ Mutant 1: 5’ ATG GCA GAG TCG AGT TG 3’ Mutant 2: 5’ ATG GCT TGA GTC GAG TTG 3’ Mutant 3: 5’ ATG GCT AGA GTT GAG TTG 3’ Mutant 4: 5’ ATG GCT AGA AGT CGA GTT G 3’ Mutant 5: 5’ ATG GCT AGA ATC GAG GTT 3’Help me please
- A reversion is a mutation that returns a mutant codon back to acodon that gives a wild-type phenotype. At the DNA level, this typeof mutation can be an exact reversion or an equivalent reversion. An equivalent reversion produces a protein that is equivalent to thewild-type protein in structure and function. This outcome canoccur in two ways. In some cases, the reversion produces thewild-type amino acid (in this case, glutamic acid), but it uses adifferent codon than the wild-type gene. Alternatively, an equivalentreversion may substitute an amino acid structurally similarto the wild-type amino acid. In our example, an equivalent reversionhas changed valine to an aspartic acid. Because aspartic andglutamic acids are structurally similar—they are acidic aminoacids—this type of reversion can restore wild-type structure andfunction.Here is the question: The template strand within the codingsequence of a gene has the following sequence:3′–TACCCCTTCGACCCCGGA–5′This template produces the…For the given mutation below,please write down the reverse mutation and any intragenic suppressor mutations for that mutation. Use the codon table for amino acids as reference. In this case, mutation means single letter change. Mutation: AGA -> AGC Arg codons: CGU, CGC, CGA, CGG,AGA,ACG Ser codons: UCU, UCC, UCA, UCG, AGU, AGC Character limit is 10 characters. Write down Reverse mutation sequence first and then intragenic suppressor mutation sequence. Write down the mutated sequence not the mutation.Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The mutation is underlined. A codon table can be reached by clicking this link. CGA to UGA O silent O frameshift O nonsense O missense
- The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'The figure shows the position of two of these mutations a and b. The nucleotides are altered in these 2 different swo-1 mutant alleles. Use the genetic table to describe any AA changes.Name the type of mutation and describe its effect on swo-1 mRNA and protein for each of the mutations. 3. The swo-1 a mutation (insertion between C and G). 4. The swo-1 b mutation (C-to-T mutation for indicated C). 5. The swo-1 a mutation leads to worms with more body wall muscle, whereas worms with the swo-1 b mutation are not able to move. Based on these phenotypes and the findings from questions 3 and 4, describe the role thewild-type version of this protein plays in muscle function.
- Describe the mutation that occurs in the following examples (be specific, if possible): BOAT to BAT SOAP to SOUP PAY to PLAY GCTCT to GCACT TGCCC to TACCC CATGC to GATGC TATATA to TACATAA wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertionBelow is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'