Q: Determine what the statement is describing. Fill in the blanks with the correct/best answer. 1. Gen...
A: Genetic engineering is the act of altering genetic material by interfering with genetic processes in...
Q: From the options below, select the most likely effect of a mutation that causes cyclin B to be unabl...
A: Cell division is of two types: mitosis meiosis
Q: 1 2 3 4 6 7 8 9
A: Fishes : A limbless cold blooded vertebrate animal with gills and fins wholly living in water.
Q: Please answer fast Briefly describe the pathways the body can use to make each of the Big Four clas...
A: The 4 classes of macromolecules are - carbohydrate Lipid Protein Nucleic acid Carbohydrate pr...
Q: Give a short description how two-point discrimination test is carried out in the lab.
A: Introduction:- The skin's two-point discrimination test is a simple sensory nerve function test. The...
Q: Molecule #3 a)What Group? (Carb, Lipid, Protein, or Nucleic Acid). b)Within the group, how would you...
A: Introduction: Males' main sex hormone is testosterone. It is a steroid hormone produced by the leydi...
Q: Aside from the existing taxonomic classifications of protozoans, what are the other possible ways of...
A: The science of classification of plants and animals is known as taxonomy. The division of living org...
Q: Which of the following plants adopt to adapt to the dry and hot environment? (Check all that apply) ...
A: Plants are multicellular organisms in the Plantae order that rely on photosynthesis for survival. Th...
Q: In birds of paradise that populate tropical rainforest ecosystems, bright colored beaks and feathers...
A: In the ecosystem of tropical rainforests, most of the birds have bright colored beaks and feathers. ...
Q: The cell membrane is made up of many diferent kinds of proteins. These proteins can be clasited as e...
A: The cell membrane mainly consists three types of proteins in it. Those are (1) Peripheral protein ;(...
Q: What is the virulence factor of Mycobacterium tuberculosis
A: Virulence factors are specific molecules of pathogenic organisms that cause the invasion against the...
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Q: Which of the following are not used for mechanical digestion? A. Pancreatic juice B. Saliva C. Bile ...
A: F- none of the above. Mechanical digestion involve mastication however chemical digestion involved ...
Q: 1. Discuss how the transcending functions are associated with the integrative levels of organization...
A: Ecosystems are arranged to help researchers better understand the context in which they are being ex...
Q: Fig. 1: Vpr counteracts LAPTM5 to promote HIV-1 infection in macrophages.
A: Vpr is the accessory protein of HIV-1 that reinforce the infection in macrophages and LAPTM5 (lysoso...
Q: What are the functions of the cardiovascular system?
A: The cardiovascular system consists of the heart, blood vessels, and blood. Its primary function is t...
Q: Which of the sequences below do you think would most likely be found in an intrinsically disordered ...
A: Amino acids : There are twenty amino acids which are found in the body . Three letter words denote a...
Q: 5. Which positioning would you choose for Flumist? Why?
A: FluMist is a flu vaccine in the form of a nasal spray and is administered through the nose to provid...
Q: Which bulb shaped structures found at the end of neurons form connections with the dendrites and som...
A: Introduction :- A neuron is a nerve cell that serves as the foundation of the nervous system. In man...
Q: if you were going to move a vesicle or organelle from one place to another within a cell, describe t...
A: If we were going to move a vesicle or organelle from one place to another within a cell,nuclear enve...
Q: 8. With respect to hemoglobin, how do you think carbon monoxide can cause hypoxic (low- oxygen) tiss...
A: Carbon monoxide poisoning is a leading cause of accidental death in the United States. It's importan...
Q: Explain the anatomical concept associated with biology, chemistry and homeostasis
A: The anatomical concept associated with biology, chemistry, and homeostasis are:- In anatomy, the b...
Q: An aerobic culture is grown in a continuous bioreactor at 28C and the product of yield was found to ...
A: Introduction A bacterial culture in which growth is allowed to take place in an environment with nor...
Q: distinguish between bacterial cells that obtained the plasmid and those that did not
A: Bacteria are single celled organisms with a unique internal structure.
Q: 2. Indicate possible patterns of inheritance for the RARE traits shown in each of the pedigrees belo...
A: This particular pedigree shows following traits: 1. The affected trait appeared in generations in wh...
Q: NASA describes desertification as the wearing down of the land, a reduction in land productivity tha...
A: Desertification is the process by which natural or human causes reduce the biological productivity o...
Q: The den network of fibers that connect the two hemispheres is called the corpus Callosum. Much of wh...
A: The left and right hemispheres of the brain are symmetrical. The opposing side of the body is contro...
Q: What traits or innovations allowed movement of animals onto land, and why might these traits have be...
A: Physical or behavioural adaptations are possible. A physical adaptation is a form of structural adju...
Q: A metabolic pathway_____ . a. may build or break down molecules b. generates heat c. can include red...
A: A metabolic pathway is a set of chemical events seen in biological processes that aid in the convers...
Q: Suppose a person with the co-dominate blood form and a person with recessive blood form type get mar...
A: Introduction: Codominance is a heterozygous condition in which both alleles at a gene locus are ful...
Q: How could you describe the process shown below? Farming reduces forest area Deforestation reduces ra...
A: By examining the above process it can be concluded that the terms Diverging process and Neutral proc...
Q: Tay Sachs disease is a recessive lethal. Abnormally shortened fingers are the heterozygous form of ...
A: Alleles are the alternative forms of a gene that are located on the same locus of homologous chromo...
Q: Dystrophin is mutated in the disease, causing a codon to change from GGA to UGA. What is the consequ...
A: Dystrophin is a protein that helps keep muscle cells intact.
Q: to
A: 20 common Defense Mechanisms people use for Anxiety-very well mind. Defense mechanism help the ego c...
Q: Look at these two plates. Which organism is most susceptible to antibiotics?
A: Q. Look at these two plates. Which organism is most susceptible to antibiotics?
Q: 2. Examine this pedigree chart. mode of inheritance is shown? Explain how you arrived at this decisi...
A: The pedigree chart shown here is a popular tool used in Genetics to explain the mode of inheritance ...
Q: The endocrine system is composed of glands that secrete hormones that regulate the activity of diffe...
A: The pituitary gland is called the master gland because hormones secreted by it control the activitie...
Q: What do you mean by “colony” of microorganisms?
A: The earth ecosystem is full of various organisms. These organisms are prokaryotes or eukaryotes. The...
Q: Functional Group Name Structural Diagram (draw all bonds) Found where in the body??? Hydroxyl H -N H...
A: Functional groups can be described as the groups of molecules that get linked to organic molecules a...
Q: How are these examples of phenotypic plasticity? 1. Haman weight 2. UV exposure 3. Flower color/pH
A: Answer :- 1. Human weight :- Phenotype is the noticeable physical or biochemical qualities of a in...
Q: Identify and explain the process by which cells expel materialsin bulkb
A: The movement of chemicals through the cell membrane is referred to as cell transport. The ability of...
Q: In what cellular process does the drug target play a role?
A: Cells are separated from their surroundings by the cell membrane.
Q: What are terpenes? 2. Essential function of terpenes in plants? 3. What is the difference between te...
A: The secondary metabolites in plants helps in defence and communication. The secondary metabolites ar...
Q: One of the frist steps in isolating plasmid DNA via mini-prep is to pellet the cells after O/N cultu...
A: 1) The use of Resuspension buffer in the extraction or the isolation of the plasmid from the DNA is ...
Q: Which of the following are mechanisms which prevent clotting under normal circumstances? Select all ...
A: Blood clotting is a complex phenomena which usually occurs when due to any reason blood vessels are ...
Q: Why would one use the Goldman-Hodgkin-Katz equation? • What is the role of the Na+/K+ pump in establ...
A: Introduction :- In cells, the Na+K+-ATPase pump aids in maintaining osmotic balance and membrane pot...
Q: Describe and identify on which segment of the legs/limbs would you expect the ambulatorial, fossoria...
A: Fossorial legs: * These legs are also called as digging legs. *Forelimbs of insect contains Fossori...
Q: QUESTION 1 Vaccination increases the number of: different receptors that can recognize a pathogen ep...
A: The term vaccination is associated with the action responsible for stimulating the human body’s acti...
Q: what are the different taxonomic classifications of protozoans
A: Introduction :- Protozoa are heterotrophic, unicellular eukaryotic organisms. They can either live f...
Q: The same team of researchers sets up an additional cross with this same population. They cross two f...
A: Dominant allele always express themselves in heterozygous condition.
Please answer fast
Step by step
Solved in 2 steps
- Question B plz no plagerism plzQuestion:- Using the following terms to describe a grassland ecosystem NPP ,GPP ,Re , primary production, secondary production, trophic efficiency, grazer food web, detrital food web, and consumption efficiency. Simple definitions will not receive full creditQuestion 6 When very few patches are occupied by a species, the overall colonization rate will be relatively This is because there are O low, very few colonizers to establish new metapopulations O low; very few open patches to colonize O high; very few colonizers to establish new metapopulations O low; very few open patches to colonize A Moving to another question will save this response. 12 米 对 17 tyo 2# $ & 2 3 4 5 7 8. 9 Q W Y A S F G H J K X V R N
- Question D plz no plagerism plzMoving to another question will save this response. Question 29 This plant community is most often found in the southern part of Wisconsin and can be described as scattered oaks in a rich, mesic soil. There are only 526 acres of this plant community remaining in the state. O Oak Barrens O Oak Savannah O Oak Mesic Woods O Woody Mesic Oak O Friendly Acres A Moving to another question will save this response. Botany Final Co....docx tab caps lock shift esc ! 1 Q A summer botany....docx NO 2 → W Z I # 3 S с E X $ 4 D H ANGIOSPERMS....docx R G Search or type URL C. % 5 MacBook Pro F T V 6 G Y D & B 7 H U * CO 8 N J= 9 K M ) 0 0 L H P >> 型 + 11 { [ Show All ? 1 } I option command ] X dMoving to another question will save this response. Question 10 ock This plant community covers about 16% of the state, however nearly half of it was lost until new protections were implemented in 1980. O Savannah O Wetland O Northern Forest O Pine Barrens O None of these A Moving to another question will save this response. Botany Final Co....docx esc 7423 1 control Q A N summer botany....docx @ W S X 1 option command H E D < SA 4 C R ANGIOSPERMS....docx G Search or type URL F do L % 5 V T MacBook Pro 6 G Y B & 7 H U N * 00 8 I J 1 + M ( 9 K
- QUESTION 12 Various plant species provide value as food crops, fuelwood, lumber, paper from trees, and useful scientific knowledge. What term best describes this type of value? a. Economic services b. Bioprospecting potential c. Value for ecotourism d. Ecologic provisions e. Natural benefitsQuestion 9 In order for an ecosystem to have proper biogeochemical cycles, that ecosystem needs at least.... I. primary producers II. decomposers III. herbivores II and III only Il only I and III only I, II, and III I and II only I only 0/1 pointQuestion 5 In a closed canopy forest, a large oak tree dies and falls. This created a large opening in the canopy. In a few years, how would the plant community in this area be different than the other parts of the forest? O This area would have more late successional, shade tolerant species O This area would have the exact same species as the other parts of the forest O This area would have more early successional, shade intolerant species O This area would have more bottomland species A Moving to another question will save this response.
- QUESTION 3 Below are 12 statements related to an ecological succession. Read through the list and place the numbers in thg text boxes, in the appropriate section of the Venn diagram. 1. 2. No previously existing life. 3. Occurs after a storm. 4. A climax community eventually forms at the end. 5. Triggered by a fire 6. Starts as the result of a receding glacier 7.. Previously existing life in habitat. 8. Features pioneer species. 9. Starts in a lake with sediment and a community. 10. Starts on bare rock. 11. Pioneer organisms form soil. 12. Happens relatively slowly. 13. Happens relatively quickly Primary succession Secondary successionQUESTION 3 a) Discuss briefly on secondary productivity in an ecosystem.Question 11 What is a community? O it describes how energy moves among species and the ecosystem it describes how global cycles impact nutrient availability O it describes the abiotic factors impacting the growth of a population O it describes interactions among species A Moving to another question will save this response. f5 文 f6 esc 米 & 2 6 ab Q W E T Y # M