* Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG Part of a sequence of DNA from a person with a genetic disease is: TAG TAA CCA CCC AGG The possible codons for some amino acids are shown in the table. Amino acid Codons glycine GGU GGC GGA GGG isoleucine AUU AUC phenylalanine UUU UUC serine UCU UCC UCA UCG Which amino acid is missing from a person with this genetic disease?
Q: A Section of a Gene CTA AAA TAG TCT For the DNA sequence shown above, identify the following: mRNA…
A: A biological process in which the information present in DNA is copied to RNA (mRNA) is known as…
Q: UUU UUC UUA UCU) UCC UÇA UCG UAU Tyr UACS Phe UGU U Ser UGC Cys UUG Leu UAA Stop UGA Stop A UAG Stop…
A:
Q: Consider the following chart: What type of mutation is this? DNA: TAC GCA TGG AAT MRNA: AUG CGU ACC…
A: By the translation process polypeptide chain is being synthesized from the mRNA sequence by the help…
Q: Compare the two DNA sequences shown below and consider the single nucleotide mutation made in the…
A: Quality transformations include adjustment in the construction of qualities which changes or alters…
Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…
A: Protein is made up of a chain of monomeric subunits called amino acids joined together by peptide…
Q: Which of the following base pairs is the least tolerant of allowed pairings at the third base of the…
A: The Wobble Hypothesis is defined as a theory that explains the reason for multiple codons coding for…
Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…
A: The central dogma of life can be stated as follows: Replication of DNA to form new copies of DNA…
Q: Complete the tables below to determine the polypeptide chain of a functional and mutated hemoglobin…
A: 1st Six Codons of the Functional Hemoglobin Gene... DNA.. GTG CAC CTG ACT CCT GAG mRNA codon is ..…
Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…
A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…
Q: Below is a segment of RNA, transcribed from a DNA sequence. Provide an example of each kind of…
A: Any detectable, inheritable qualitative or quantitative change in genetic material of an organism…
Q: Using a table that shows which codon represents which amino acid determine the following: A)…
A: The three nucleotide sequence either DNA or RNA is called codons.During protein synthesis, it codes…
Q: What do you have a nucleotide triplet codes for codon for UGU ? Identify a base pair substitution…
A: The DNA nucleotide triplet codes for RNA triplet codon which further codes for specific amino acid.…
Q: Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the…
A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure which act as genetic material in…
Q: What are the possible codons that a tRNA molecule could interact with if it is carrying each of the…
A: A codon is a triplet nucleotide of DNA or RNA corresponding during protein synthesis to a particular…
Q: What is the initiator codon in both prokaryotres and eukaryotes? What amino acid is specified by…
A: The codon AUG is known as the START codon as it the principal codon in the deciphered mRNA that goes…
Q: The amino acids listed above that are coded by the mRNA codon
A: Protein synthesis is a major process inside our body .Our body has complex system for protein…
Q: True or False Degeneracy of Genetic Code: 1. a given amino acid has more than one codon 2. the…
A: True or False Degeneracy of Genetic Code: 1. a given amino acid has more than one codon 2. the…
Q: CUGACUGACUGA A template strand of DNA in a gene reads: TGG CTG GGT GCT ACA. GUCAGUCAGUCA Using the…
A: Firstly DNA template strand undergoes transcription process to form RNA. After that translation…
Q: Here is our DNA sequence: T-A-C-A-T-G-T-T-T-A-G-G-T-C-C-A-C-C-C-G-T-G-G-G-A-C-T Write the RNA…
A: Introduction The process by which the genome's DNA is copied in cells is known as DNA replication.…
Q: What amino acid does the codon AGC code for? Use the chart below. Thr (threonine) Arg (arginine)…
A: Genetic code was discovered by crick. It is the sequence of nitrogen bases in mRNA molecule which…
Q: Table 1. The Genetic Code: Codons and Their Amino Acids First Two Nucleotides of Codons Last…
A: B). UUA - LEUCINE C) GAG - GLUTAMATE D) UAUCUA- TRYOSINE, LEUCINE E) AUCUUG - ISOLEUCINE, LEUCINE…
Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…
A: A DNA molecule is a double-helical structure.
Q: List all single base substitutions that would change a codon for Leu to a nonsense codon. For each,…
A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…
Q: Some tRNAs can recognize more than one codon because there is a relaxation of the complementation…
A: Translation of mRNA into protein requires a specialized adapter molecule called tRNA and ribosomes.…
Q: For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and…
A: Translation is a technique which refers to the process of translating mRNA sequence into amino acid…
Q: When examining the genetic code, it is apparent that ________. there are 44 stop codons…
A: The process of polypeptide chain synthesis or protein synthesis is known as translation. By this…
Q: The genetic code uses combinations of 3 RNA bases as letters, each triplet specifies only one amino…
A: A genetic code is a triplet code of nucleotides that codes for a specific amino acid. It is also…
Q: Which of the following mRNA codons could be changed to a stop codon by a single base pair…
A: A codon consists of three-nucleotides (A, G, C, or U) of RNA and carries the genetic information.…
Q: Second letter A G UUU Phenyl- UUC alanine UAU UAC UGU UGC Oysteine UCU Tyrosine UCC Serine UUA UUG…
A: The genetic codon present in the mRNA will be translated during the translation process by ribosome…
Q: Need help to answer the following questions. Not sure if my answers are right.
A: DNA has a double helix structure. Both the strands are antiparallel that is if the one strand has 3'…
Q: Write the codons for the following amino acids. 1. Phe 2. Val
A: Genetic codon: - It is the 3 nucleotide sequence of DNA and RNA, all bases are involved in formation…
Q: These are portions of the coding strands of DNA for Wild-Type Hemoglobin and the mutated hemoglobin…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…
A: Given is a DNA template with a sequence and it consists of two exons and introns in it.Exons are the…
Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…
A: Mutations in the DNA molecule are caused by a spontaneous alteration. After a synonym mutation, the…
Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…
A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…
A: The amino acids are coded by the group of three bases called base triplets and codons.
Q: A SNP that results in loss of all catalytic activity of a drug-metabolizing enzyme is most likely to…
A: snip is genetic variation which may leads to replace cytosine with thymine at the same places along…
Q: Translate the RNA codons using the given genetic code 5' A-U-C-G-A-C-G-A-U-C-C-G-A-U-C-G-A-U 3'
A: Translation: Translation is the process by which ribosomes in the cytoplasm or endoplasmic…
Q: Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA…
A: The gene expression in the cells is brought about by the various processes of Replication…
Q: Lgh ndrome is a metabolic disorder that affects the cetral nervous system a mutation in the MT-ATP6…
A: Proteins are synthesized from mRNAs through translation. mRNAs are synthesized through…
Q: Refer to the codon diagram on. Which of the following is a codon that will terminate translation? *…
A: The process of formation of a polypeptide sequence from an mRNA transcript is known as translation.…
Q: For the codon sequence : 5’ GGA – AUA – UGG – UUC – CUA – 3’…
A: The translation is the process in which proteins are synthesized from the RNA. The ribosome and tRNA…
Q: The genetic information contained in DNA consists of a linear sequence of coding units known as…
A: From the given case, it is known that the E. coli DNA has a size of 4.70 X 106 bps. As, it is given…
Q: A template strand of DNA in a gene reads: CCA AGC TCT. Using the codon chart provided, what is the…
A: Translation: Translation is the process by which ribosomes in the cytoplasm or endoplasmic…
Q: Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…
A: Untranslated regions are present in RNA which are transcribed but not translated on either end of…
Q: Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second…
A: Ans is.. methionine
Q: THE CODONS THAT CODE FOR THE AMIMO ACID SER (SERINE) ARE UCU, UCC,_____ AND _____
A: Codon: A three-nucleotide sequence in DNA or RNA that encodes a protein amino acid or indicates the…
Q: A small section of bacterial mRNA has the following nucleotide sequence: GAC CCG AUG AAC The tRNA…
A: Translation It is the synthesis of proteins from the codons present in the mRNA. Anticodons…
Q: The following pattern has been observed in the genetic code. For many codons, the first base…
A: The genetic code is a three-letter code employed by living cells to translate the information into…
Q: Which of the following is/are codon/s for Glutamic Acid? O CAA GAA O GAG O GAA & GAG CAA & CAG
A: Codons are tri-nucleotide sequences of a DNA or RNA molecule which code to specific amino acid, as…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine ThreonineThe chart can be used to determine the amino acid that a specific codon encodes. Finl Second Letter Thind Letter U с A G phenylalanine serine tyrosine cysteine U phenylalanine serine U tyrosine cysteine с leucine serine stop stop A leucine serine slop tryptophan G leucine proline histidine arginine U leucine proline histidine arginine с leucine proline glutamine arginine A leucine proline glutamine arginine G isoleucine threonine asparagine serine U isoleucine threonine asparagine serine C isol cine threonine arginine A (start) lysine lysine threonine arginine G valine alanine aspartate glycine U valine alanine aspartate glycine C valine alanine glutamate olycine A valine alanine glutamate glycine G If a strand of DNA had the sequence GACTTC, then mutated to be GACATC, what sequence of amino acids would be formed? Aspartate and phenyalanine become apartate and isoleucine Leucine and lysine become leucine and tyrosine Aspartate and phenyalanine become aspartate and methionine Leucine…If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letter
- The genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of glutamate during translation of a hemoglobin chain. Using the table of codons below, determine the mutation in DNA that produces this disorder. 1st position ✓ U C A G Select one: U C serine phenylalanine phenylalanine serine leucine serine leucine serine leucine leucine leucine leucine isoleucine isoleucine isoleucine methionine Table of mRNA Codons 2nd position valine valine valine valine proline proline proline proline alanine alaninc alanine alanine A tyrosine tyrosine a. CUC changes to C AG b. GAA changes to GUU c. CTT changes to CAT d. C A G changes to CTC stop stop threonine asparagine threonine asparagine threonine threonine histidine histidine arginine arginine glutamine arginine glutamine arginine lysine lysine G cysteine cysteine stop tryptophan aspartate aspartate glutamate glutamate serine serine arginine arginine glycine glycine glycine glycine 3rd position DCMO U С A G U C A G…The sequence of a polypeptide is determined by the order of codons that specify the amino acids in the polypeptide. How many different sequences of codons can specify the polypeptide sequence methionine-histidine-lysine? (Use the table to find the number of possibilities.) SECOND BASE UAU UACFTyrosine (Tyr) UAA -Stop codon UAG -Stop codon UUUL UGU Cysteine (Cys) UCU uc UCA FSerine (Ser) uca Uuc Phenylalanine (Phe) UUAL Leucine (Leu) CAU CAC CAA Glutamine (Gin) CAGF UGA -Stop codon uaa -Tryptophan (Trp) CGU сос CGA FArginine (Arg) CU CU Histidine (His) CuA FLeucine (Leu) Cua) Proline (Pro) CCA cca AAU Asparagine (Asn) AGU Serine (Ser) AGC AUU ACU ACC Threonine (Thr) AACF AAA AAGLysine (Lys) AUC Fisoleucine (lle) AUA Methionine (Met) AUG - Start codon ACA ACG AGA AGGFArginine (Arg) GU GACAspartic acid (Asp) GGA GAA Glutamic acid (Glu) Gaa) GcU -Valine (Val) G GUA GCA FAlanine (Ala) Glycine (Gly) 8. 1 4 THIRD BASE 2. FIRST BASEUse the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letter
- Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)Second letter C A UUU Phenyl- UUC alanine UCU UCC UAU UAC UGU UGC Tyrosine Cysteine Serine UCA UCG UAA Stop codon UAG Stop codon UGA Stop codon UGG Tryptophan UUA A Leucine UUG CCU ССС CAU CAC CUU CGU CGC Histidine C CUC C CUA Leucine Proline Arginine CCA СCG CGA CGG A CAA CAG CUG Glutamine AGU AGC AUU AAU ААС ACU Asparagine Serine AUC Isoleucine A AUA ACC АСА Threonine AAA AGA Methionine; start codon ACG Lysine Arginine AUG AAG AGG U GUU GUC GUA GCU GCC GCA GAU Aspartic GAC acid GGU GGC GGA GGG Valine Alanine Glycine GAA Glutamic GAG acid GUG GCG G Given the codon UCA in the first exon of a gene, which change is most likely to result in a nonsense mutation? A transversion of A to U Change of nucleotide in the third position Change of nucleotide in the first position A transition of A to G Change of nucleotide in the second position First letter Third letterGiven the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…
- For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G1. The UAU and UAC codons in MRNA both specify What feature of the genetic code explains this? Second letter C UUU Phenyl- UUC alanine UAU UAC UCU Tyrosine UGU UGC Cysteine UCC Serine UCA UUA UUG UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan Leucine UCG CAU CÁC CUU CUC CUA CUG CGU CGC CCU CC CCA CCG Histidine Leucine CGA Arginine CGG Proline CAA CAG Glutamine AUU AUC Isoleucine A AUA AAU AAC Asparagine AGU ACU ACC ACA ACG AGC Serine Threonine AAA Methionine; start codon AGA AGG Arginine AUG AAG Lysine GUU GUC GAU Aspartic GAC acid GCU G GUA GUG GCC Alanine GCA GGA Glycine GGG GGU GGC Valine GCG GAA Glutamic GAG acid Chp 米 144 Third letter UCAG UCAGUCAGU CAG First letterOn the space provided, type the translation product of wild-type gene A (use three- letter abbreviation for the amino acids; use - to indicate a peptide bond). 5' CTAATCGCCTAATCCGCTTGCGGCCAT 3'