o Acid uence /hich kind of protein molecule did this gene make? How does this protein help the body maintain homeostasis? nclusion Questions: 1. Examine the protein you created. If the DNA strand that you started with had a change in it (A changed to G), what would happen to the protein made?
Q: Describe the molecular genetics process using proper scientific terminology. Describe the steps that…
A: Molecular genetics has been proved to be revolutionary. From producing bulk drugs of animal origin…
Q: Lesson 2 Focus Questions 1. What chemicals and molecules are needed for PCR, and what is the…
A: Introduction: Polymerase chain reaction (PCR) is a laboratory method used to rapidly produce…
Q: Exercise 3 Polymorphism Polycystic Kidney disease (PKD) is a disease caused by an abnormal gene…
A: Since there are multiple questions in this particular question, I'll answer the first three subparts…
Q: Restriction enzymes look for a very particular KIND OF sequence. What is that called. Give me an…
A: Restriction enzymes are enzymes which digest DNA sequence at a particular recongition site. Examples…
Q: A. What do scientists do to adult cells to make them “behave” like embryos? B. Transgenic, cloned…
A: The embryo is formed from the fusion of the male gamete and the female gamete in the process of…
Q: What are the issues on generally modified organisms GENETICALLY MODIFIED ORGANISMS? List at least 5…
A: Genetically modified organisms (GMO) hold great promise, but many concerns some legitimate and some…
Q: Explain Shortly. I need help The emergence of new molecular biology techniques has allowed…
A: You have asked three parts of a question. Third part is a personal opinion on this topic, so I won't…
Q: Which characteristics describe the genetic code of humans? Select three options. can help in the…
A: Genetic code is the term we use for the manner in which the four nitrogenous DNA bases — A, C , G,…
Q: 17. Which pair of scientists discovered the structure of the DNA double helix and helped to make…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Questions: 1. Why are plasmids used as vector for DNA Recombination? What other vectors can be used?
A: Note - we answer one question at a time. In the DNA recombination process, the specialized…
Q: 2. How does Bial's test differentiate RNA from DNA?
A: Bial's test is a chemical test that is performed to test the presence of pentoses.
Q: What is the difference between cis- and trans-acting sequences? 2.Describe the basic concept of a…
A: 1) Cis acting sequences refered to the regulatory sequences in DNA which is capable of controlling…
Q: Would it be better to have your DNA sequences and find out about your genetic health? 2. What if the…
A: The technique of detecting the genomic DNA sequence, or the sequence of nucleotides in DNA, is known…
Q: Molecular Cloning What does molecular cloning mean (with figures/narratives) How does molecular…
A: A) Molecular cloning is a bunch of trial techniques in molecular biology that are utilized to gather…
Q: Compare and contrast the running buffers for DNA and protein electrophoresis.
A: Electrophoresis- Electrophoresis is a method that separates macromolecules-either nucleic acid or…
Q: Base on your own opinion, what does genetics mean? What is its relationship to all living things?…
A: Term genetics was given by William Bateson. Gregor Mendel is known as father of genetics. *Only…
Q: Activity 1.4: Essay.Direction: Explain your answer.Today, it is easy to make transgenic plants and…
A: Transgenic plants or animals is a genetically modified organism (GMO) whose DNA has been altered…
Q: What types of enzymes could Avery, MacLeod, and McCarty have used to destroy proteins and RNAs?
A: "Since you have asked multiple question, we will solve the first question for you. if you want any…
Q: Ten example of Human protein in therapeutic genetic technology that have available in genetic…
A: Genetic Engineering: Genetic engineering is the process of altering an organism's genetic makeup…
Q: Legrning Task 2: Make da Then, answer the gulde questions that follow. Materlals: crayons. Scissors,…
A: DNA replication is process where DNA makes multiple copy of it's genome and produce same identical…
Q: Site directed mutagenesis facilitated research ona) Carbohydratesb) Proteinsc) Lipidsd) Fats
A: Site-directed mutagenesis is a technique of molecular biology that involves the induction of…
Q: 1. Explain the comparison and the contrast of DNA and RNA polymerases activity?
A: DNA polymerases are enzymes which are involved in replication of DNA. The DNA polymerase catalyses…
Q: For gene expression profiling, what does a microarray or “gene chip” measure directly? Group of…
A: Microassay is technology-based upon the fact that a complementary sequence of DNA can be used to…
Q: . What is DNA profiling? Group of answer choices When scientists use DNA to determine what…
A: DNA profiling is also known as DNA fingerprinting. It is the process of determining an individuals…
Q: Answer the following: 1. Which pieces of DNA are the most informative? Why? 2. Explore the concept…
A: Note: Ad per Bartleby Guidelines, For Remaining Answers Please Repost The Question. Introduction:…
Q: Q3. Using the mutated DNA parental template sequence, follow it through to the resulting polypeptide…
A: The gene or small portion of DNA undegoes transciption to form mRNA and then this mRNA undergoes…
Q: Answer the following: 1. Which pieces of DNA are the most informative? Why? 2. Explore the concept…
A: The process of determining the sequence of nucleotide bases (As, Ts, Cs, and Gs) in a molecule of…
Q: Q:The ethicas of gene therapy in curing fatal genetic disease? 9:17 AM //
A: Gene therapy is a branch of medicine that focuses on genetically altering cells to provide a…
Q: How do you use FISH(fluorescence in situ hybridization) to detect gene rearrangement? Describe an…
A: FISH is a molecular cytogenetic technique that employs fluorescent probes that bind to just those…
Q: Genetics question
A: Eukaryotic cells contain the nucleus, whereas the prokaryotic cells lack it.
Q: Which BLAST type allows you to compare and find genetic similarities between proteins? a.…
A: BLAST stands for Basic Local Alignment Search Tool and refers to a set of programmes that build…
Q: Im having trouble answering this question. What type of cells can be altered by GETs like CRISPR…
A: The gene therapy or gene editing is an asset for humans, as many of the gene-related disorders can…
Q: Q.1. Imagine you are working for a research laboratory and you are asked to help with the following:…
A: In genetic engineering, restriction enzymes are very important they act like molecular scissors and…
Q: A. How can DNA be used to pass on inheritable material & make proteins?
A: DNA or deoxyribonucleic acid is our genetic materials that is present in the nucleus of the cell. It…
Q: What is the enzyme that eventually joins the sugar-phosphate backbones of the Okazaki fragments and…
A: DNA recombination technology is a technique in which foreign DNA is joined with host DNA to form…
Q: (AKS 8a1, DOK 2) Some students in biology classes at Meadowcreek HSs were researching the pros and…
A: The first organisms in the laboratory to be transformed were genetically modified bacteria because…
Q: Pro's/con's of genetic testing. This can be as simple as for birth defects or in more complicated…
A: DNA testing, commonly referred to as genetic testing, is used to spot alterations in chromosomal…
Q: (AKS 8a2, DOK 1) What are the benefits of using the biotechnology technique shown below? A. В. С. D.
A: Ans: The given image is of resolved DNA bands on an agarose gels. This technique has been…
Q: 56. What is the chromosomal anomaly not detected by the technique given in the picture? Cy3 Cy5 a.…
A: Array CGH is an array based comparative DNA hybridization . It is a hybridization technique done on…
Q: Activi Direction: Write the Pros and Cons of the effects of gene therapy to health and to the…
A: Gene therapy replaces a faulty gene or adds a new gene in an attempt to cure disease or improve your…
Q: elp ASAP, thank you! (question is asking to pick Which 6 features are shown in the figure?)
A: The reaction given in the figure shows the enzyme catalyzed reaction with the formation and breakage…
Q: DIRECTION: CLASSIFY THE DIFFERENT APPLICATIONS OF RECOMBINANT DNA TECHNOLOGY CHOICES: A-…
A: Recombinant DNA technology includes the production of recombinant DNA with the desired set of genes…
Q: Who are the scientists that proved DNA is the transferrable genetic material and Discuss how they…
A: Introduction DNA was never thought to be the genetic material as it was so inert and lacking…
Q: (AKS 8a, DOK 2) Students in biology classes at MHS have been conducting an experiment that invloves…
A: Genetic engineering technique is the technique of biotechnology in which the required genes are…
Q: Doc -2 Therapeutic Drugs Doc-1-Introduction: Specific applicati ons of genetic engineening are…
A: Genetic engineering is defined as the process of utilizing recombinant DNA (rDNA) technology to…
Q: 2. If a selection assay be made to identify cells that have incorporated the recombinant DNA, what…
A: Recombination in terms of genetics describes the process that explains the exchange of genetic…
Q: P 10² 10 1 10' 102 10 1o Cot (mole x sec/L) Britten and Kohne showed that once double-stranded DNA…
A: The diagram shown above is the cot curve. It explains the dentauration process. In this process…
Q: 3A. Were the effects of this mutation, beneficial, harmful, or neutral? Justify your position based…
A: Answer: Mutation = These are the changes occured in the nucleotide sequence of a DNA which can be…
Step by step
Solved in 2 steps
- Answer: giycogen Time left 0:4T:- If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. GCGCGCGCGCGCGCGCGCGCG O b. GGGGGCCCCCAATTCCCCCCC O c. AAAAAATTTTTCCCCCGGGGG O d. ТAСТАСАСTGTGGTTAАТТААА Oe. АТАТАТАТСGСGTTAAATTCTА CLEAR MY CHOICE Match the given words with the most suitable words from the given list. Unicellular fungi Hyphae Choose... Охуgen Atom ENG سطح المكتب11:29 Protein 6-10092015113530.pdf https:api.schoology.comv1attachment169963838... Name Class Date 2. How are enzymes involved in this process? 3. hаppens anzips"? 4. Why is it important that exact copies of DNA be made? 5. Suppose that a sequence of one DNA strand is T-A-C-A-A-C-G-T-G. What is the corresponding sequence on the other strand? E Concept Mapping The construction of and theory behind concept mapping are discussed on pages vil-ix in the front of this Study Guide. Read those pages carefully. Then consider the concepts presented in Section 7-1 and how you would organize them into a concept i page 74. Notice that the concept map has been started for you. Add the key Now look at the concept map for Chapter 7 on concepts you are important Secti When you have finished the chapter, you will have a completed concept map. 69 1 of 1b. The diagram below is of a short stretch of prokaryotic chromosomal DNA in the process of replication. Please supply the specific pieces of information requested by the boxes below. 1. What enzyme relaxes the supercoils? 2. What enzyme unwinds the DNA? 7. What does this arrow represent? 3. What enzyme synthesizes the RNA primer 8. Why should this single-stranded portion be stabilized? 4. What is this short segment of DNA called? 9. What enzyme synthesizes this long DNA segment? 5. What enzyme removes the RNA primer and replaces it with DNA? 10. Is this the leading or the lagging side? 6. What enzyme joins the short segments of DNA together? 3
- INSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a. complimentary DNA strand 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C b. mRNA 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C c. protein synthesized 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A CThird letter UCAG UCAGH CAC First letter Part 5: Coding Practice 1. Use this sequence of DNA to answer the following former test questions: 5'-- TTAATGGGACAGCTTGTGTAGAGG --3' a. What is the complementary strand of DNA? b. Using the complementary strand of DNA (your answer from part a) as the template strand, what is the transcribed mRNA sequence? C. What is the amino acid sequence translated from the strand of mRNA synthesized in part b (use the genetic code below)? Remember: i. Start codon! ii. Stop codon! bac ocent Seond letter UUU Phe UAU Tyr UGU UGC Cys UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp G C. UUA UCA UUG Le UCG [ CAU ] CAC CUU CGU His CUC C CGC ne. CCA Arg Pro CUA CAA CGA CCG CAG Gin CGG CUG AAU 1 AAC Asn ACU AGU [ [ AUU AUC Ile AGC Ser Thr A AUA AGA AGG ACA AAA Arg AUG Met ACG AAG GUU GCU GAU GGU Asp GAC GCC GGC GUC Val G GUA GCA Ala GAA GGA Gly GAG Glu GGG GUG GCGQuestion:- Many cancer treatment drugs specifically target DNA synthesis/replication. Find a drug that is currently used in cancer treatment Tell me what it is used for (e.g. any specific types of cancers?) What specific DNA process does it target? From a molecular biology perspective (what you have learned so far), what are the negative outcomes of targeting this process?.
- 7:07 1 How Mutations Occur (Developing) Question O Practice It! /// A Select the statement(s) that accurately describe the function of DNA polymerase and the types of mutations that may occur. O Point mutations occur when a single nitrogenous base is substituted. Frameshift mutations occur when a nitrogenous base is inserted or deleted. start d le O Point mutations are less serious than frameshift mutations, as only a single base pair is affected. DNA has rare mutations during replication because DNA polymerase functions to build and repair errors in nitrogen base pairings of A-G and T-C. 3 Pro O DNA has rare mutations during replication because DNA polymerase functions to build and repair errors in nitrogen base pairings of A-T and G-C. O Point mutations occur when a nitrogenous base is inserted or deleted. Frameshift mutations occur when a single nitrogenous based is substituted. B.McKenzie - Uncontrolled Cell Growth B.McKenzie - Uncontrolled Cell Growth B.McKenzie - Uncontrolled…Part C: The Big Picture – In this part, you will use the information from Part A and Part B so answer questions. 1. When you were creating the complimentary DNA strands, what bases (letters) paired together? Were there any bases that could pair with more than one base (letter)? 2. Using the following DNA sequence, ATTACGCATATG, what would the sequence of the complimentary strand be? 3. Could DNA be replicated without the use of enzymes? Explain your answer by giving specific examples. 4. If you replicate on strand of DNA, how many do you end up with? Are the strands identical to the original or different? How do you know? The bases that Paired to)ether Wa s1_30*_SP23 - General Biology I (for majors)/1 of us page The anticodon sequence created from the following DNA: TACGGGGCTGAGATT F1 Select one: O a. Tyr-Gly-Ala-Glu-lle O b. AUGCCCCGACUCUAA c. UACGGGGCUGAGAUU O d. Met-Pro-Arg-Leu-STOP F2 # 80 F3 $ 000 000 F4 % F5 MacBook Air F6 & r F7 DII F8
- -66 The following sequence of the DNA template strand contains: 5'AGGCTCCAGG 3' out of Which complementary RNA strand can be made from this sequence? uestion Select one: O a. 5' UCACAGGUCU 3" O b. 5' UCCGAGGUCU 3" O c.5' CCUGGAGCCU 3' O d. 5' UGGCTCCUGC 3' e. 5' GACCTCGGAA 3"Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…Which answer correctly summarizes the plcture below: A. 8989回 B. (A) is showing a DNA strand and (B) shows that DNA strand wrapped around proteins. (O is showing further folding of DNA untilit gets to (D) aheavily condensed chromosome, CWisshowing a condensed chromosome and (B) shows the chromosome wrapped around proteins. (C) hows the furtherflding.of the chromosome to form the end result of DNAshown as (D). Mhowing a hlycondensolchromosome that goes through funher folding shown in (B) (Oshowing a DNAmeecutrwith (D) showinghow DNAwraps around proteins JALNONAan(8rshows.ho atbNA omake.proteinsC,shaws