Minimal Selective Concentration (MSC) is _______. - the concentration of antibiotic needed to prevent pathogenic bacteria growth - the concentration of antibiotic required to positively select for antibiotic resistance genes (ARG)
Q: a. What are the linkage distances between m and r, between r and t, and between m and t?b. Determine…
A: The coefficient of coincidence signifies the degree of interference in a crossover event. A value…
Q: 2. What is the best way to approach toileting with persons with Alzheimer’s disease? Upon request…
A: Proactive:Observe their routine: Look for signs they might need to use the restroom, like…
Q: I need help woth this question please
A: Step 1: Do some research about atlantic coast and pacific coast. Step 2: Get the most important…
Q: Pick all that are true In the 1940s, DNA was established as the molecule of heredity in experiments…
A: Option a: This option is incorrect because Transduction: This process involves the transfer of…
Q: Give answer of all parts with final answer
A: The problem is asking us to find the concentration of Ca(OH)2 in a solution at 25°C given that the…
Q: 14. Blood concentration of ____ will increase with bone resorption (breakdown). A. Ca2+ B. Cl- C. K+…
A: B. Cl- (chloride ions): Chloride ions are not directly related to bone resorption. While chloride…
Q: How is HLA serologic testing performed? Question 28 options: a) HLA…
A: HLA serologic testing is a method used to identify the human leukocyte antigen (HLA) types in an…
Q: how is the heridetary material organised in the nucleus and the chromosomes
A: The hereditary material in a cell is organized in the nucleus, which is a membrane-bound organelle…
Q: Based on the information provided by the Angus pedigree below, Princess Alta of Wey (R) is inbred. T…
A: Inbreeding occurs when an animal's parents are more related than the average individual in the…
Q: Is this disease autosomal or sex-linked, and dominant or recessive? Using your genetics…
A: Based on the given information, we can conclude that the disease in question is most likely…
Q: make a pathophysiology flow chart of Upper Respiratory Tract Infection with a data of: 3 months old…
A: The objective of the question is to understand the pathophysiology of an Upper Respiratory Tract…
Q: List and describe 4 of the main regulators of the cell cycle. Then describe the involvement of a CDK…
A: First, there are four primary regulators of the cell cycle:Cyclins are proteins that bind to…
Q: Here is the complete mRNA sequence from a bacterial cell: 5'…
A: To determine how many tRNAs will bind to the ribosome to make the protein, we need to consider a few…
Q: Male cockroaches use their sense of smell to find food but also to detect receptive females. Discuss…
A: Anatomy:Antennae: possess specialized hair-like structures known as sensilla, which detect both food…
Q: The following results are obtained on sample run during a routine doctor's visit. WBC 152.0…
A: Chronic Lymphocytic Leukemia (CLL) is a common type of leukemia characterized by the proliferation…
Q: please help me answer these questions. thank you! 1A.) How has our society's view of sexuality…
A: I hope these suggestions and recommendations help you with your assigned tasks. Have a great day…
Q: Imperial China during the Ming dynasty (1368-1644 CE) could conceivably have started the Scientific…
A: The question is asking us to identify which of the given factors would not have contributed to…
Q: need correct answer please providee
A: a) Schedule of Cost of Goods ManufacturedWe start with work in process beginning (3rd column)Next,…
Q: In Nicholas Copernicus’ heliocentric model of our solar system, the above planet would have to be:…
A: Nicholas Copernicus, a Polish astronomer from the 16th century, revolutionized our understanding of…
Q: Case Study Analysis 4.2 Explain natural/acquired immunity and active/passive immunity 4.3 Explain…
A: Case Study 1: Julia and the MMR VaccineExplanation of Natural/Acquired Immunity and Active/Passive…
Q: In a river in Ontario, 270 Atlantic salmon were captured and fin-marked with a numbered T-bar anchor…
A: The problem is asking us to estimate the population of Atlantic salmon in a river in Ontario. The…
Q: Questions 8-10, Answer the questions below based on information provided below: You crossed the…
A: Identifying Cells with ArmS10 or Wg OverexpressionFor the first question, your explanation is…
Q: If two people with sickle cell traits (AS genotype) have three chidren, what are the chances that…
A: When two individuals with the sickle cell trait (AS genotype) have children, there are three…
Q: The above atmospheric gas or fluid does not contribute any of its atoms to which of the following…
A: Photosynthesis is the process by which green plants, algae, and some bacteria use sunlight to…
Q: i found this past paper but cant find the answers for my revision. please can you answer question 1e
A: Answer well explained above
Q: Genetics Question 1
A: Detailed explanation:Based on the image above, we can say that the statement is FALSEDNA will move…
Q: What evidence did Georges Cuvier present that contradicted one of Jean-Baptiste Lamarck’s ideas? he…
A: The objective of the question is to identify the evidence presented by Georges Cuvier that…
Q: In the last century, Paul Ehrlich dreamed of a “magic drug” that could eliminate pathogens while…
A: Ehrlich's dream of a targeted pathogen killer became a reality with antibiotics. Here's how they…
Q: Although a common myth about bones is that it is dead, our bones are constantly changing. For…
A: Osteoblasts are special cells in our body that help make new bone. When our bones need to get…
Q: According to chemist John Dalton, if one mole of oxygen is combined with two moles of hydrogen to…
A: The atomic mass of an element is the weighted average mass of the atoms in a naturally occurring…
Q: If I give you three species- a bacterium, an algae and an animal, which two species are more likely…
A: The objective of the question is to identify which two out of the three given species - a bacterium,…
Q: Use the provided graph to examine the relationship between temperature and photosynthetic rate…
A: Let's use the provided temperature data for Davao, Philippines, along with the peak oxygen…
Q: Figure 1 from Wilson et al. (1990) shows the locations of the primers and the length of the PCR…
A: Sure, let's break down the figure and the modifications made:1. **Orientation and Strand…
Q: Which of the following statements about heterochromatin is FALSE? It contains…
A: The false statement from the given choices is:Histone proteins in heterochromatin are heavily…
Q: why is the genetic code or hereditary information, referred to as the key to life as we know it?
A: The genetic code or hereditary information is often referred to as the 'key to life' because it is…
Q: Why are contaminants such as TCE (trichloroethylene) and PCB (polychlorinated biphenyls) so…
A: The most difficult aspect of removing TCE and PCBs is:They easily adsorb onto organic matter in the…
Q: 8. True or False: The person-centered approach focuses on the person’s personal preferences and…
A: The person-centered approach is based on the notion of acknowledging and appreciating each…
Q: Alfred Russel Wallace agreed with Charles Darwin about which of the following evolutionary ideas?…
A: The objective of the question is to identify the evolutionary idea that both Alfred Russel Wallace…
Q: Lactic acid is a biproduct formed at the end of anaerobic respiration. This molecule is dangerous to…
A: Approach to solving the question: I hope this helps! Detailed explanation: Examples: Key references:
Q: You plan to clone exon 11 of the HEXA gene (Section C) into the multiple cloning site (MCS) of the…
A: PCR Amplification:PCR (Polymerase Chain Reaction) is a technique used to amplify a specific DNA…
Q: Starting at rest, an object falls 144 feet in a vacuum (acceleration = 32 feet per second2). If the…
A: The problem is asking us to find the time it takes for an object to fall a certain distance in a…
Q: Table 1 Volume measurement Individual (L) Class average (male) (L) Class average (female) (L) Cycle…
A: 1. Mean Tidal Volume (TV) Calculation: - Add up all individual TV values and divide by the number…
Q: Topic: Epidemiology of Substance Use Disorders What makes this topic (Epidemiology of Substance Use…
A: Let's delve deeper into the topic of the epidemiology of substance use disorders and why it's of…
Q: This is from the Wilson et al. article.
A: Primer PC3mod (PURPLE)Recognition sequence: 5' TGCCAGCGAGTCAAGTCGGGAACTCT 3'Direction of…
Q: A bacterial strain is growing exponentially. At 1:00pm the titre of the culture is 2x10^3 cells per…
A: The objective of the question is to determine the number of generations that have elapsed, the…
Q: What evidence did Georges Cuvier present that contradicted one of Jean-Baptiste Lamarck’s ideas? he…
A: Jean-Baptiste Lamarck was a French biologist who proposed one of the earliest theories of evolution.…
Q: The KM of a Michaelis-Menten enzyme for a substrate is 1.0 x 104 M. At a substrate concentration of…
A: To solve this problem, we will be using the Michaelis-Menten equation: V=Km+[S]Vmax[S]Now let's…
Q: Past paper
A: (a) A complicated interaction of multiple immunological variables causes the concurrent rise in…
Q: I need help making changes to this essay using these research articles: Wood, H. L., Spicer, J. I.,…
A: The objective of the question is to revise the given essay on the impact of ocean acidification on…
Q: A certain amber suppressor inserts glutamine in response to the amber codon. What is the most likely…
A: Recognition of amber codon: Due to the mutation in the anticodon, the amber suppressor tRNA^(Gln)…
AI-generated content may present inaccurate or offensive content that does not represent bartleby’s views.
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- Katelyn had been working for Dr. Johnson for a month, and while she had become quite good at measuring inhibitionzones, she didn’t know why she was doing all this work. She had gotten very curious after she began doing all themeasurements on a new set of antibiotics. # is experiment involved infecting mice with MRSA and tracking how theMRSA grew over time.Data were collected by counting the cells of MRSA taken from $ uid samples from the mice. # e cells were measuredby taking one gram of the $ uid and spreading it over plates, but now Katelyn counted the colonies that grew on theplate after 24 hours. Because there were so many, she actually measured the colonies as “log CFU/g.” A CFU is acolony forming unit, or essentially a cell that will divide into a colony that can be seen. Because there can be so many,Katelyn measured them on a logarithmic (log) scale. # e raw data in her lab notebook looked like the following:Table 1. E% ect of treatment on MRSA in mice after 24 hours of drug…TRY TO KEEP IN SHORT AND USE OWN WORD FOR THIS QUESTION You are studying a type of bacteria isolated from the acidic water runoff of a mining operation. You subject two batches of the same bacteria type to different environmental growth conditions. One batch is grown at pH 2, while the other is grown at pH 7. All other environmental parameters are kept identical between the two batches. You then collect their proteins and run a Western blot using an antibody that binds to a proton efflux pump protein (which actively expends energy to pump protons out of a cell). How would you characterize the information obtained in this experiment? What does it tell you, and why is that potentially valuable information?Transfer of resistance to a new family of antimicrobial agents from one strain to another s following a genetic mechanisms? 1) Conjugation 2) Transduction 3) Transformation 4) Transposition 5) Recombination
- Before development of a vaccine against this microbe, thedisease it caused accounted for two-thirds of bacterial meningi-tis cases during the first year of life but is still the number oneleading cause of mental retardation in patients who survive seri-ous disease due to permanent central nervous system disorders.What is the microorganism?(a) Haemophilus influenzae type B(b) Haemophilus influenzae type A(c) Neisseria meningitidis(d) Streptococcus pneumoniae(e) Listeria monocytogenesThe ____ plasmid contains genes for synthesizing connections between donor and recipient cells.A bacterium can protect itself against antibiotics in different ways. Describe 4 fundamentally different mechanisms of antibiotic resistance. Discuss if there are any basics differences or similarities between these 4 mechanisms and if so describe these.
- A(n) ____ is a substance that can kill or inhibit the growth of infectious microorganisms antibiotic vector toxin reservoirAntibiotic resistance can be transferred from one bacterial cell to another. Describe how this process can occur.The table below shows the response of our ESKAPE safe relatives to 4 bacteria isolated from a master grid. We do not know the identity or any characteristics of the unknown bacteria. Each safe relative was spread onto a petri dish using aseptic technique. A grid pattern was taped to each plate and the unknown bacteria were patched into one of the squares. If there was no inhibition visible, including with a magnifying lens, the result was listed as -. If there was an inhibition zone between 1 and 10mm in diameter, the result is listed as +. If the inhibition zone was greater than 10mm, the result is listed as ++. Page 50 in your research guide states: "Some antibiotics are broad spectrum, meaning that they affect a wide range of bacteria. Other antibiotics have a narrow spectrum of activity. One anatomical feature that plays a significant role in the susceptibility of a microbe to a particular antibiotic is its cell wall composition (discussed in Section 8)". Research the cell wall…
- The table below shows the response of our ESKAPE safe relatives to 4 bacteria isolated from a master grid. We do not know the identity or any characteristics of the unknown bacteria. Each safe relative was spread onto a petri dish using aseptic technique. A grid pattern was taped to each plate and the unknown bacteria were patched into one of the squares. If there was no inhibition visible, including with a magnifying lens, the result was listed as -. If there was an inhibition zone between 1 and 10mm in diameter, the result is listed as +. If the inhibition zone was 10mm or greater, the result is listed as ++. In the lab, the MGC instructors plated all 6 of the ESKAPE pathogen safe relatives on LB agar plates. Then we patched Unknown Bacteria 5 from a Master plate onto the safe relative. The results are shown here: METRIC METRIC METRIC 1 B. subtilis S. epidermidis E. coli Complete the final column (Unknown Bacteria 5) of the table by selecting -, +, or ++ using the criteria in the…The table below shows the response of our ESKAPE safe relatives to 4 bacteria isolated from a master grid. We do not know the identity or any characteristics of the unknown bacteria. Each safe relative was spread onto a petri dish using aseptic technique. A grid pattern was taped to each plate and the unknown bacteria were patched into one of the squares. If there was no inhibition visible, including with a magnifying lens, the result was listed as -. If there was an inhibition zone between 1 and 10mm in diameter, the result is listed as +. If the inhibition zone was greater than 10mm, the result is listed as ++, Page 50 in your research guide states: "Some antibiotics are broad spectrum, meaning that they affect a wide range of bacteria. Other antibiotics have a narrow spectrum of activity. One anatomical feature that plays a significant role in the susceptibility of a microbe to a particular antibiotic is its cell wall composition (discussed in Section 8)". Research the cell wall…Choose the false statement: Penicillin is a ß lactam which inhibits bacterial growth by inhibiting DNA polymerase. O Resistance to ß lactamase inhibitors arises when bacteria duplicate the ß lactamase gene. O B lactamase inhibitors are prescribed together with antibiotics like penicillin in order to combat resistance to these antibiotics. Question 10 Choose the false statement below: OUsing multiple antimicrobials in combination is an ineffective strategy because they generally are redundant in effect and the chance of drug resistance will be increased. O Because of its complex structure and multiple binding sites, the ribosome is the target for multiple types of antibiotics. O Choice of an antimicrobial agent may be dependent upon the material treated as well as the susceptíbility of the microbe.