How would nucleotide excision repair be affected if one of the followingproteins was missing? Describe the condition of the DNAif the repair was attempted in the absence of the protein.A. UvrAB. UvrCC. UvrDD. DNA polymerase
Q: In an EMSA, the binding of a protein to DNAa. prevents the DNA from being digested with a…
A: Electrophoretic mobility shift assay (EMSA) is used to identify deoxyribonucleic acid (DNA)-binding…
Q: Indicate whether each of the following statements is true or false. If a statement is false, explain…
A:
Q: How can reverse transcriptase inhibitors slow the replication of DNA? Give an example that…
A: DNA, or deoxyribonucleic acid, is defined in the universal term that is a genetic substance found in…
Q: DNA fragments that are 500 bp, 1000 bp, and 2000 bp in length are separated by gel electrophoresis.…
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: The function of a restriction enzyme is to a. prevent the movement of DNA outside the nucleus b.…
A: Restriction enzymes:- these are the proteins and mostly isolated from prokaryotes. These enzymes…
Q: What would be the result if an organism’s telomerase were mutated and nonfunctional? a. No DNA…
A: A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes. It is…
Q: ) Base excision repair requires polymerases. B.) In DNA repair by excision, the non-damaged strand…
A: Solution : Correct option is d
Q: The polymerase chain reaction uses Taq polymerase rather than a DNA polymerase from E. coli, because…
A: Taq polymerase is use to amply the DNA in polymerase chain reaction
Q: DNA polymerases ___. catalyze carbon bonding seal gaps in the sugar-phosphate backbone add new…
A: DNA STRUCTURE:- DNA structure is given by Watson and Crick, who proposed the double-helical…
Q: The flask where you grow the E. coli culture got exposed to UV rays, explain what kind of DNA damage…
A: In order to maintain the integrity of information contained in DNA, it has various repair…
Q: In nucleotide excision repair in E. coli, the function of the UvrA/UvrB complex is toa. detect DNA…
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule. DNA replication is the process by which…
Q: Explain why base excision repair, nucleotide excision repair, and mismatch repair—which all require…
A: Mutations are changes that occurs in the deoxyribonucleic acid (DNA) sequence, either due to…
Q: Negative supercoiling may enhance activities like transcriptionand DNA replication because ita.…
A: DNA (deoxyribonucleic acid) supercoiling is the coiling of double helix upon itself. If the ends of…
Q: The palm domain of a DNA polymerase O contains the catalytic site of the enzyme CIC Site
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: Which model accurately represents the semi-conservative nature of DNA replication? Figure A Figure…
A: Semiconservative mode of DNA replication means half conserved DNA synthesis.
Q: The enzymes DNA polymerase in E.coli is a DNA dependent polymerace and also has the ability to…
A: DNA replication is the semiconservative process. The DNA polymerase is the main replicative enzymes…
Q: DNA glycosylase inhibitors are used to study which DNA repair mechanism?
A: DNA glycosylase inhibitors are used to which DNA repair mechanism?
Q: the most efficient general strategy for whole genome sequencing is ? (a) double the coding sequence…
A: Whole-genome sequencing abbreviated as WGS is a method used to comprehensively analyze the entire…
Q: Describe the excision repair process in DNA, using the excision of thymine dimers as an example.
A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material which has all the stored genetic…
Q: DNA polymerases ____. a. add new nucleotides to a strand b. repair DNA c. assemble new…
A: DNA replication is heterocatalytic process by which a new DNA strand is synthesized on a old DNA…
Q: Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the…
A: * Okazaki fragment are short sequences of DNA nucleotides. * They are of approximately 150 to 200…
Q: One of the mechanisms that leads to the DNA mutations is a process known as DNA polymerase slippage…
A: DNA slippage is a type of DNA strand misfiring mechanism that occurs in the repeated nitrogenous…
Q: Explain the molecular mechanism of DNA polymerization by DNA polymerase and explain why DNA…
A: DNA replication is necessary to ensure genetic continuity and genome inheritance from parents to…
Q: Which of the following Is true of the leading strand? A it is synthesized discontinuously at the…
A: Leading strand is synthesized continuously and lagging strand is synthesized discontinuously. Both…
Q: Pyrimidine dimers in DNA may be repaired by in E. coli cells. (select all correct answers) Select…
A: The most well-known DNA lesion involving a single DNA strand is pyrimidine dimer. It is an…
Q: During DNA replication, the two new daughter DNA strands have to be made at the same time in the…
A:
Q: Which mechanism requires the ability to distinguish between newly synthesized and template strands…
A: DNA is the double stranded structure in which genes are located. Usually it functions as genetic…
Q: What are the differences between In vitro and In vivo DNA replication? Please answer at your own…
A: Question: What are the differences between Invitro and Invivo DNA replication? Answer: Invitro DNA…
Q: What is/are the attributes that make nucleotide excision repair (NER) and base excision repair (BER)…
A: Deoxyribonucleic acid (DNA) is a hereditary molecule that passes genetic information from one…
Q: Discuss the following statement: “the DNA repair enzymes that fix deamination and depurination…
A: DNA is made up of two connected strands which loop about each other like a helix structure, giving…
Q: From which end of a strand of nucleic acid does DNA polymerase I REMOVE nucleotides? A) 5' B) 3'…
A: DNA polymerase 1 has three types of polymerase activity. 1. 5'-3' polymerase activity- It is…
Q: Which of the following is not a DNA repair mechanism?
A: DNA repair is a set of procedures through which a cell detects and repairs damage to the DNA…
Q: Base analogs are mutagenic because of which characteristic? a. They produce changes in DNA…
A: Mutagens are physical, chemical, or biological agent that induces mutation by changing the gene…
Q: In DNA amplification, using the Taq polymerase, what is the maximum number of amplification cycles?…
A: Introduction In the field of molecular biology, however, cloning is viewed at a genetic molecular…
Q: Which repair process(es) use(s) a DNA polymerase? Select all that apply. base excision repair…
A: DNA polymerases are the enzyme required for the synthesis and replication of DNA. There are…
Q: Which of the following is NOT common to all repair mechanisms? A. Detection of the lesion B. Removal…
A: A change in the fundamental structure of DNA that is not reproduced when the DNA is replicated is…
Q: . Which of the following statements best describe the mismatch repair pathway?a. It is part of the…
A: DNA polymerases include a group of enzymes that are responsible for the synthesis of DNA during DNA…
Q: The following diagram represents a DNA molecule that is undergoing replication. Draw in the strands…
A: Chromosomes are carrier of deoxyribonucleic acid (DNA). DNA is the genetic material. Each species…
Q: What is the function of resolvase in recombination? a. It unwinds double-stranded DNA. b. It allows…
A: Recombination is an exchange of genetic information among DNA molecules. It is an essential genetic…
Q: DNA polymerases that corrects errors and mismatches in DNA is called? A. Post replication repair…
A: Although DNA replication is an extremely exact process, errors can occasionally happen, such as when…
Q: The initial mechanism for repairing nucleotide errors in DNA is ________. a. mismatch repair b. DNA…
A: The biochemical molecule that is built up with two polynucleotide chains is called DNA…
Q: A.) Damaged DNA can be reversed if nucleotides can be replaced with a proper nucleotide for a…
A: DNA repair : The DNA molecule may undergo some alternations due to various factors like exposure to…
Q: The problem of synthesizing the lagging strand, in the sense that DNA synthesis can only occur in…
A: DNA synthesis is the formation of new DNA molecules from the parental strand by utilizing…
Q: Which of the following is not required for Sanger sequencing of DNA? OA. ddNTPs B. DNTPS C. A DNA…
A: Sanger sequencing is a method of DNA sequencing.It involves selective incorporation of chain…
Q: Nucleotide excision repair A. recognizes and repairs thymine dimers and other damaged bases in…
A: It is an important excision mechanism that removes DNA damage induced by ultraviolet light.
Q: Which of the following statements describe reversal of DNA repair mechanism. A. UV light blocks the…
A: Solution : correct option is C
Q: Compare and contrast the different types of DNA repair mechanisms.
A: The technique by which double-stranded deoxyribonucleic acid (DNA) is duplicated and two clones are…
Q: Prokaryotes use methylation as a major mechanism of DNA protection because (A) methyl groups include…
A: Prokaryotic cells do not have a distinct nucleus but are situated within a cell, called the…
Q: (a) Why the plasmid (containing the foreign DNA), together with the competent bacterial cells are…
A: The purpose of molecular cloning is to make numerous copies of a recombinant DNA molecule, and…
How would
proteins was missing? Describe the condition of the DNA
if the repair was attempted in the absence of the protein.
A. UvrA
B. UvrC
C. UvrD
D. DNA polymerase
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Match the following type of DNA repair mechanism with the most appropriate definition. Nucleotide excision repair Homologous recombination Base excision repair Nonhomologous end joining A. Repairs thymine dimers by removing a section of the strand B. Corrects damaged bases by removing only the base C. Repairs double strand breaks by joining the ends D. Repairs double strand breaks by copying second chromosomeWhat is/are the attributes that make nucleotide excision repair (NER) and base excision repair (BER) similar and/or different from each other? Select the correct response: The NER pathway is the only one that can remove DNA lesions in the strand regardless of their size which is followed by attaching the correct strand, then sealed by a DNA ligase. They both use the enzyme DNA glycosylases that recognizes the damaged DNA segments and proceed with repairing the faulty base in the strand. They differ NER only repairs purine bases while BER repairs pyrimidine bases. They both remove the damaged parts of the DNA where the BER pathway corrects only the identified damaged bases which are usually non-bulky lesions. The NER pathway, on the other hand, repairs the damage by removal of bulky DNA adducts which is a short-single stranded DNA segment. They both utilize the enzyme photolyase to reverse the damages created by the faulty section of the DNA. They both remove the damaged parts of the…Indicate whether each of the following statements is true or false. If a statement is false, explain why it is false. A. The repair polymerase is the enzyme that proofreads the newly synthesized strands to ensure the accuracy of DNA replication. B. There is a single enzyme that degrades the RNA primers and lays down the corresponding DNA sequence behind it. C. DNA ligase is required to seal the sugar-phosphate backbone between all the DNA fragments on the lagging strand. D. The repair polymerase does not require the aid of the sliding clamp, because it is only synthesizing DNA over very short stretches. Answer the following questions about DNA replication. On a DNA strand that is being synthesized, which end is growing the 3' end, the 5' end, or both ends? Explain your answer. А. B. On a DNA strand that is being used as a template, where is the copying occurring relative to the replication origin-3' of the origin, 5', or both?
- Pyrimidine dimers in DNA may be repaired by in E. coli cells. (select all correct answers) Select one or more: O a. photolyase O b. nucleotide excision repair O c. mis-match repair O d. methyl-transferaseAll of the following proteins function during nucleotide excision repair, EXCEPT: A. DNA pol B. Uvr A C. Uvr C D. Ligase E. GyraseThe general excision repair pathway for DNA repair has the following order A. endonuclease cuts → DNA ligase removes → endonuclease removes → DNA ligase B. DNA ligase → DNA polymerase → helicase or endonuclease removes → endonuclease cuts C. endonuclease cuts → helicase or endonuclease removes → DNA polymerase → DNA ligase D. endonuclease cuts → DNA polymerase repairs → helicase opens up → DNA ligase
- Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…Describe the genetic roles of DNA helicase and DNA polymerase. Contrast the function of DNA polymerase with thatof RNA polymerase.Which of the following types of DNA damage would be hardest to repair using the DNA repair pathways?A. Complete removal of three nucleotides in the middle of one strand.B. A covalent bond between a base on one strand and a base on the complementary strand.C. Incorporation of a sugar other than deoxyribose into one strand.D. Covalent attachment of a short polypeptide to a single base.E. A covalent bond between a base and a deoxyribose on the same strand. Please explain why it's B
- DNA repair enzymes preferentially repair mis- matched bases on the newly synthesized DNA strand, using the old DNA strand as a template. If mismatches were instead repaired without regard for which strand served as template, would mismatch repair reduce repli- cation errors? Would such a mismatch repair system result in fewer mutations, more mutations, or the same number of mutations as there would have been without any repair at all? Explain your answers.Enzyme function is critically important for the proper replication of DNA. Predict the consequence of a loss of function for each of the following enzymes. a. DNA gyrase b. DNA polymerase III c. DNA ligase d. DNA polymerase IIdentify the various types of DNA repair mechanisms known to counteract the effects of UV radiation. Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Reset Help SoS repair is dependent on a photon-activated enzyme that cleaves thymine dimers. excision repair is the process by which an endonuclease clips out UV-induced dimers, DNA photoreactivation repair polymerase III fills in the gap, and DNA ligase rejoins the phosphodiester backbone. recombinational repair uses the corresponding region on the umdamaged parental strand of the same polarity. is a process in E. coli that induces error-prone DNA replication in an effort to fill gaps by inserting random nucleotides.