hat is Embden-Meyerhof pathway of RBC metabolism, explain as simple as possib
Q: 1 Suppose that you have 1ml of a buffer solution with a pH of 6.8 and you add 1ml of 2% starch…
A: Salivary amylase is an enzyme that works on catalytic digestion of starch. Salivary amylase…
Q: Retroviruses, like the HIV, contain an enzyme called reverse transcriptase. Explain the flow of…
A: Retroviruses are viruses with an enzyme known as reverse transcriptase. Transcription is the process…
Q: 2. ( To the right is a schematic diagram of His the active site in the Michaelis complex of a-chy-…
A: Chymotrypsin is a protease that cleaves a peptide at the C-terminal of all aromatic amino acid.…
Q: What is the terminal electron acceptor in photo- phosphorylation?
A: By activating PSII, photophosphorylation converts ADP into ATP using the energy of sunlight. It…
Q: 1. Proteins act as structural components such as keratin of hair and nail, the collagen of the bone…
A: "Since you have posted a question with sub-parts we will answer the first 3 question for you. If you…
Q: Spectrophotometric determination of riboflavin at max 445 nm.
A: When Lab scientists have to be measured total protein by UV-spectroscopy some important things…
Q: Where would the catalase enzyme perform best- in the human blood stream OR in the human stomach?…
A: Catalase is common enzyme found in all aerobics and it convert reactive oxygen species H2O2…
Q: Given Sorbitol, Briefly explain its expected reaction (based on their structural formula) to the…
A: Molisch's test is the specific test for Carbohydrates which give purple colour ring on addition of…
Q: How does compromised pyruvate kinase activity lead to anemia? (3 sentences)
A: Pyruvate kinase is a glycolysis enzyme that plays a role in the last phase. It catalyzes the…
Q: How does 2, 4 Di Nitro Phenol raise human body temperature when used in a weight-loss program?
A: 2,4-Dinitrophenol (DNP) is a yellow, crystalline substance with a sweet, musty odour. It sublimes,…
Q: Section B: True / False (5 marks) 1. Primase has a DNA dependent RNA polymerase activity. 2.…
A: True or false statement Primase is a kind of RNA polymerase that is involved in the replication of…
Q: Which organ typically does not use fatty acid oxidation as a source of ATP? Liver Brain…
A: Fuel molecules are those biomolecules that upon oxidation yields the body with ATP. Our body uses 4…
Q: Match the best possible fit for the following Animal virus replication stages. A. Attachment B.…
A: Viruses contain nucleic acid/ribonucleic acid in the core region while the exterior/…
Q: Derivatives of purines and pyrimidines make up the base component of nucleotides. Select the…
A: Purines and pyrimidines are nitrogenous bases that makeup two types of nucleotide bases in DNA and…
Q: How is a “committed step” defined in the context of a metabolic pathway and why are they important?…
A: A metabolic pathway is a series of biochemical reactions that are interconnected by their…
Q: 5. Amino acid methionine is used as medicine due to its lipotropic ellect («removes» fat excess from…
A: The orange structure is the liver The red arrows indicate the transport is happening via the blood…
Q: Which statement is FALSE concerning glycolysis? Group of answer choices It is activated by high…
A: Glycolysis isa catabolic pathway that occurs in cytosol by breaking down of glucose into pyruvate…
Q: a) Give an appraisal of prokaryote cell lines as recombinant polypeptide expression systems. (b)…
A: The bacterial expression system is widely used for the recombinant expression of mammalian proteins.…
Q: What polysaccharide is used as storage of carbohydrates in humans and animals? Group of answer…
A: Carbohydrates – fibre, starches, and sugars — are nutritional elements that the body converts into…
Q: Question 3 -- / 1 What form(s) of chemical energy are generated during cyclic photo-phosphorylation?…
A: Introduction: Photophosphorylation is the process by which photosynthetic organisms use the energy…
Q: A. Effect of pH with enzymatic activity. Include example of enzymes optimum pH. B. Effect of…
A: The enzymes are biological catalysts, that enhance the rate of biochemical reactions. The factors…
Q: Describe surroundings at home which reminds you about biochemistry and relate the situation to…
A: related to this : proteins A situation to describe : Cooking
Q: what transport proteins are involved is getting ca2+ out of cytosol
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: The picture below shows the body's response to acute stress, which is to release adrenaline…
A: Introduction: Adrenergic neurons release norepinephrine as the primary neurotransmitter. These…
Q: At which position(s) are amino acids limited to those Which amino acid(s) are more commonly found at…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: With the aid of diagrams describe the signalling pathway involving inositol 1,4,5 trisphosphate from…
A: Membrane phospholipids can act as precursors from which second messengers can be produced during…
Q: Classify the following amino acids base on their side chain if it's either -Non-polar aliphatic R…
A: Amino acids are the molecules that contain an amino group and a carboxylic group linked through the…
Q: Review method used to increase the solubility of a drug under the following headings co solvents PH…
A: Bioavailability is a powerful determinant of drug absorption. It represents the administered dose…
Q: Why egg whites and milks are used as antidotes for heavy metal poisoning?
A: Heavy metal poisoning is a process in which an organism is exposed to excessive amount of heavy…
Q: Which of the following has the strongest tendency to gain electrons? Select one: O a. FAD O b.…
A: The electrons released from NADH and FADH2 are transferred to molecular oxygen in ETC to generate a…
Q: HN-CH- HN-ÇH-C- -OH HN- CH 1 2 3.
A: Each amino acid has a N-terminal (-NH2 group), a C-terminal (-COOH group) & a R-group or the…
Q: What does protein function in the human body?
A: Proteins are made up of amino acids or we can say that amino acids are the building block of…
Q: A. They carry unneeded cholesterol back to the body's liver, where it is eliminated. 7. Which…
A: Lipids are amphipathic molecules that contain both polar and non-polar parts present in them. Lipids…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: H o-H H Н-С-н `cc- .と、 H toluene phenol エ エ 工王 \\
A: Retention factor The amount which each component of a mixture travels can be easily quantified using…
Q: Н Но H OH HO, OH H HN- a. Glucocerebroside CH3 OH H3C -N-CH,- CH2-0-P-01 HN CH3 b. Sphingomyelin
A: Glucocerebrosides are lipid derivatives composed of sphingosine, fatty acid and a glucose residue.…
Q: How many molecules of water are produced by the electron transport chain during the complete aerobic…
A: Stearate is saturated fatty acids. It is metabolized by beta oxidation in the cytoplasm. It releases…
Q: Enzymes accelerate the rate of a reaction by: a. lowering the number of molecules with lower…
A: Introduction: Enzymes are biological catalysts that fasten the speed of the chemical reaction. They…
Q: Identify if the following is a pyrimidine/purine nucleotide or a pyrimidine/purine nucleoside and…
A: The structure of pyrimidine/ purine nucleoside or pyrimidine/ purine nucleotide with ribose or…
Q: 2. Explain the difference between saturated and unsaturated fats.
A: Fats often refers to triglycerides which is esters of glycerol and fatty acids. One glycerol can be…
Q: Match the following descriptions to the given choices. A. Aldosterone The first molecule in the…
A: 1. The first molecule in the biosynthesis of steroids that contain the…
Q: production of Ribose 5-phosphate in the Pentose Phosphate Pathway is needed in the synthesis of…
A: Pentose phosphate pathway, also called the hexose monophosphate shunt or phosphogluconate…
Q: What is another name for the glycolate pathway?
A: The process of respiration that is initiated in the chloroplast and take place only during day is…
Q: Can you please briefly describe the reaction mechanism that permits the detection of reducing sugars…
A: Fehling's reagent is a reagent commonly employed in differentiation of water soluble carbohydrates…
Q: What diseases are the related protein deficiency in the human body? Explain their rationale.
A: Protein deficiency occurs in the human body when the body does not get enough amount of protein that…
Q: HN- CH H2N-CH-c-OH HaN — сн—с— он | Н-N— сн—с—он CH2 CH2 ČH2 CH2 CH2 CH2 NH2 ÓH A B D H2N-CH-C. -ОН…
A: Aminoacids are the building blocks of proteins. They have two functional groups along with side…
Q: of Mg2+.Classify each analyte based on its level in the soil sample
A: Amount of soil sample = 2.65g In mg = 2.65 × 1000 = 2650…
Q: A mixture of Alanine (pl 6.02), Glutamic Acid (pl 3.22), Glycine (pl 5.79), Lysine (pl 9.74) and…
A: Ion exchange chromatography is used to separate molecules based on their net surface charge.
Q: Question 3 Aldosterone regulates sodium, potassium, and chloride ions in tissues True False
A: Aldosterone is a hormone which is secreted by the adrenal glands. Aldosterone secretion is increase…
Q: Which of the following substances ATP, CoA-SH, FAD and NAD+ have the subunits in their structure?…
A: FAD/FADH2, NAD+/NADH, and NADP+/NADPH are cellular electron carriers and ATP is the energy currency…
What is Embden-Meyerhof pathway of RBC
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- CASE STUDY #2 A 2-year-old black girl is being seen by the hematologist after her pediatrician found her to be severely anemic with splenomegaly and jaundice. Her mother gives a possible history of a “blood problem" in her family but doesn't know for sure. Her hemoglobin electrophoresis was normal, and the complete blood count (CBC) revealed a normocytic anemia. The platelet and white blood cell On the peripheral smear, there are many bizarre erythrocytes, including counts are normal. spiculated cells. A diagnosis of pyruvate kinase deficiency is made. 5. Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but intermediates above pyruvate in the glycolytic pathway build up slowing the pathway. Which of the following products may not be made in the appropriate amounts in the RBC because of the deficiency of pyruvate A. Glucose B. Oxaloacetate C. acetyl-CoA D. Lactate Explanation for answer in no. 5: ?CASE STUDY # 2 A 2-year-old black girl is being seen by the hematologist after her pediatrician found her to be severely anemic with splenomegaly and jaundice. Her mother gives a possible history of a “blood problem" in her family but doesn't know for sure. Her hemoglobin electrophoresis was normal, and the complete blood count (CBC) revealed a normocytic anemia. The platelet and white blood cell counts are normal. On the peripheral smear, there are many bizarre erythrocytes, including spiculated cells. A diagnosis of pyruvate kinase deficiency is made. 6. In the RBCS of the patient described above, which of the following would be expected ? A. ADP to ATP ratios would be elevated above normal. B. NADP+ would increase relative to NADPH. C. Ribulose 5-phosphate levels would decrease. D. NADH to NAD+ ratios would decrease. E. Methemoglobin levels would increase. Explanation for answer in no. 6:*Case Study* A 2-year-old boy fell from a backyard gym set. His shoulder and upper arm became very swollen shortly after the fall. The boy’s mother took him to the emergency department a few hours after th incident because he was complaining of pain. On physical examination, the physician noted that large hematoma had formed in the upper part of the boy’s right arm. There was no history of surgery (he had not been circumcised), injury, or illness. The boy was receiving no medication. Emergency department treatment consisted of aspirating the hematoma Subsequent to this treatment, the boy began to bleed extensively. He was admitted to the hospital. The following laboratory tests were ordered: a hemoglobin and hematocrit, platelet count, and bleeding time. Because the bleeding continued, a type and crossmatch for two units of fresh blood were ordered on a standby basis. Additional information from the mother revealed that the boy’s cousin had “bleeding problem.” Laboratory Data…
- 14- The clinic nurse instructs parents of a child with sickle cell anemia about the precipitating factors related to sickle cell crisis. Which, if identified by the parents as a precipitating factor, indicates the need for further instruction? 1.Stress 2.Trauma 3. Infection 4.Fluid overload 15-A 10-year-old child with hemophilia A has slipped on the ice and bumped his knee. The nurse should prepare to administer which prescription? 1.Injection of factor X 2.Intravenous infusion of iron 3. Intravenous infusion of factor VIII 4.Intramuscular injection of iron using the Z-track methodPatient M., 36 y/o, was found in the street unconscious. The patient has a medical history of diabetes. There is a smell of alcohol from the mouth. The skin is moist, warm, arterial pressure -145/90 mm column of mercury, convulsive twitching of muscles. Breathing is shallow, eye ball tone is retained, pupils are dilated, hyperflexion. How would you treat this patients?A. Intravenous introduction of 40-80-100 ml 40% glucose solution B. Injecting 20 units of insulin subcutaneouslyC. Injecting 20 units of insulin intravenouslyD. Injecting 500 ml 5% glucose solution intravenouslyE. Injecting 500 ml 0.9% sodium chloride intravenouslyCase Study 5:A 4-year-old boy was seen in the public health clinic because of intermittent bouts of diarrhealasting almost 4 weeks. The mother did not note any bright red blood in the stool. The child waspale, listless, and had a protuberant abdomen. He had a number of small erythematous vesicleson his feet. His mother said that he sometimes ate dirt and always had a good appetite. The familylived in a rural part and had a well from which they got their drinking water. This part of thecountry had only recently been connected to the local city’s sanitation system. The physicianinitially ordered a complete blood count with an elevated Eosinophil count. The physicianordered a stool culture for bacterial pathogens and stool examination. The bacterial culture wasnegative for enteric pathogens, but the stool examination revealed parasitic organisms and thepresence of Charcot-Leyden crystals. Diagnosis: Capillariasis Causative Agent: Capillaria philipinensis Case study presentation should…
- tein X Case Studies.docx X + rl=https://wheatland.orbundsis.com/einstein-freshair/Videos/0216D9403D0ED43358766A676D8A4817/Case+Stuc TCentral | NBA... a Amazon.com: Onlin... (6) The Reason Why... Isaiah Blames Zora... Beyond The Lights... Case Study, Chapter 26, The Digestive System Mr. McArthur is hospitalized with pancreatitis and cholecystitis. Neither his gallbladdernor his pancreas are functioning normally at this time. The client is placed on a NPO (nothing by mouth) diet order, given intravenous fluids and pain medication. The nurse is aware that the pancreas has two functions: one being endocrine, secretion of hormones to assist with glucose control and the other being exocrine, aiding the digestive system. Mr. McArthur is scheduled for gallbladder removal in the morning to treat the cholecystitis. (Learning Objective 4) 1. The client asks what his gallbladder does. What is the nurse's best response? 2. The client also asks how the pancreas works to help with digestion. What…Case study : Ms. X, a 32-year-old Hispanic woman, has had a history of intermittent pleuritic chest pain and joint pain for the past several years. Recently, she went to her physician because she noticed that an erythematous, butterfly-shaped rash had appeared on her face. Further lab tests indicated protein in her urine. Her blood test indicated the presence of numerous antinuclear antibodies, especially anti-DNA, and mature neutrophils containing nuclear material. A diagnosis of systemic lupus erythematosus (SLE) was made. Discussion Questions 1. Discuss possible reasons why SLE was not diagnosed earlier 2.Discuss how the presence of antibodies can cause such widespread damage in organ systems. 3. Discuss possible manifestations of SLE 4. Discuss treatments for SLE and a prognosis for the patient in this case.A 62-year old, recently widowed male Hispanic patient, KB. was brought in to the emergency department (ED) by his daughter for progressively worsening shortness of breath, fatigue, a lingering non-productive cough, and generalized edema. One month prior, he noticed dyspnea upon exertion, loss of appetite, nausea, vomiting and malaise, which he attributed to the flu. In the emergency department, he appeared anxious and pale, and had a dry yellow tint to the skin. He denied any chest pain, and he could not recall the last time he urinated. He has history of benign prostatic hyperplasia, diabetes mellitus type 2, hypertension, dyslipidemia, and renal insufficiency for the past two years. His ED assessment findings included: 1+ pedal edema, basilar crackles in the lungs bilaterally, and a scant amount of urine according to a bladder scan. His lab results indicated a glomerular filtration rate (GFR) of 12. Based on his subjective and objective symptoms, he was admitted with a diagnosis of…
- A 62-year old, recently widowed male Hispanic patient, KB. was brought in to the emergency department (ED) by his daughter for progressively worsening shortness of breath, fatigue, a lingering non-productive cough, and generalized edema. One month prior, he noticed dyspnea upon exertion, loss of appetite, nausea, vomiting and malaise, which he attributed to the flu. In the emergency department, he appeared anxious and pale, and had a dry yellow tint to the skin. He denied any chest pain, and he could not recall the last time he urinated. He has history of benign prostatic hyperplasia, diabetes mellitus type 2, hypertension, dyslipidemia, and renal insufficiency for the past two years. His ED assessment findings included: 1+ pedal edema, basilar crackles in the lungs bilaterally, and a scant amount of urine according to a bladder scan. His lab results indicated a glomerular filtration rate (GFR) of 12. Based on his subjective and objective symptoms, he was admitted with a diagnosis of…11:11 Back CASE #3DISCUSSI... Case #1 Patient is an 89 year old male admitted with Hyperkalemia, ESRD, HTN, and Bladder Cancer. Patient's past medical history includes recurrent bladder carcinoma, CVA, hernia repair and hemodyalisis. Patient was admitted due to weakness and 2 weeks of diarrhea for which he had refused to be dialyzed for 7 days. Patient lives s at home with wife and daughter who are both his healthcare surrogates. Based on patient's poor prognosis, oncologist had recommended on previous admissions that patient be made Hospice Care with comfort measures. Case #1 Cont. Daughter and wife have refused Hospice care and want patient to be dialyzed and continue aggressive treatment to include full resuscitation if cardiopulmonary arrest. Daughter and wife have requested all physicians to refrain from speaking to patient about his prognosis. At t this time all physicians have followed daughter and wife's request not let patient know that his cancer has returned, except for the…12-The nursing student is presenting a clinical conference and discusses the cause of B-thalassemia. The nursing student informs the group that a child at greatest risk of developing this disorder is which of these? 1.A child of Mexican descent 2.A child of Mediterranean descent 3.A child whose intake of iron is extremely poor 4.A breast-fed child of a mother with chronic anemia 13- A child with B-thalassemia is receiving long-term blood transfusion therapy for the treatment of the disorder. Chelation therapy is prescribed as a result of too much iron from the transfusions. Which medication should the nurse anticipate to be prescribed? 1.Fragmin 2. Meropenem 3.Metoprolol 4.Deferoxamine