For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5

For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5

Name: For the following short sequence of double stranded DNA, design primer
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACT

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 15CTQ: Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’

See similar textbooks

Similar questions

For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’
Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The highlighted sequences indicate the region bound by primers, either on this strand or on the other complementary strand. 5' ACGTGCGACACGTATATATGTCGCGTGAGTGTAGCGTATCGCTAGAGACGCATACCTATG 3' If the sequence of the forward primer is 5' GCGACACG 3', which of the following sequences would represent the reverse primer? a. 5’ – CAGAGATCGC – 3’ b. None of these sequences would represent the reverse primer c. 5’ – GTCTCTAGCG – 3’ d. 5’ – GCGATCTCTG – 3’ e. 5’ – CGCTAGAGAC – 3’
You want to amplify the following sequence of DNA from a gene of interest that you are studying. To do this, you will use PCR. Design a forward and reverse primer. Show where the primers anneal to the template sequence. Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’ TACTGCCTTATATTCGACCACCACCACC---CCGACGTACTCGACGTTCACACACGAGAGGATT 5’ (PLEASE EXPLAIN STEP - BY STEP) Answer : Foward primer 5": Reverse primer 3"
Your graduate advisor asks you to amplify the following sequence of DNA by PCR: 5’-ATACGCATTCGGACCAGGTCCTAA-3’ 3’-TATGCGTAAGCCTGGTCCAGGATT-5’ a. To ensure that the entire sequence above is amplified, what 6-nucleotide DNA primers should you add to your PCR mix? You order the primers listed above, but instead receive the following set of primers: 5’-CGCATT-3’ 5’-GGACCT-3’ b. What portion of the double stranded DNA molecule will be amplified after 10 rounds of PCR? Your labmate attempts to rescue your PCR reaction by providing you with the following set of primers: 5’-ATACGC-3’ 5’-TCCTAA-3’ c. What is the result of running the PCR reaction with your labmate’s primers? How many double stranded molecules of DNA will result from 10 rounds of amplification?
the one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?
Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TGCTATC 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. This primer cannot be used in the PCR process. b. It will bind to the top strand on the left side of the fragment. c. It will bind to the bottom strand on the left side of the fragment. d. It will bind to the bottom strand on the right side of the fragment. e. It will bind to the top strand on the right side of the fragment.
The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given above
Suppose you have to design two PCR primers, 16 bases in length, to amplify the whole of the 100 bp sequence that is shown below as a double-stranded molecule. 1 5' ATCACGACTGGGTATGTCCGTATATATATACACACGCTGCTGTGTACTAG 3' 3' TAGTGCTGACCCATACAGGCATATATATATGTGTGCGACGACACATGATC 5' 51 5' TATACCGTACGTACACGAGACATACATATATGGTGAGTTCACCAGACGAA 3' 3' ATATGGCATGCATGTGCTCTGTATGTATATACCACTCAAGTGGTCTGCTT 5' Which of the following would be the best choice for forward (fwd) and reverse (rev) primers? Select one: O fwd: 5' TTCGTCTGGTGAACTC 3' and rev 5' ATCACGACTGGGTATG 3' O fwd: 5' ATCACGACTGGGTATG 3' and rev 5' CTCAAGTGGTCTGCTT 3' O fwd: 5' TAGTGCTGACCCATAC 3' and rev 5' AAGCAGACCACTTGAG 3' O fwd: 5' ATCACGACTGGGTATG 3' and rev 5' GAGTTCACCAGACGAA 3' O fwd: 5' TAGTGCTGACCCATAC 3' and rev 5' GAGTTCACCAGACGAA 3' O fwd: 5' ATCACGACTGGGTATG 3' and rev 5' TTCGTCTGGTGAACTC 3'
A DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide Length
In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand
Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’ 5’ ATGGCCGGATAGATCCCGGTACCGAATTAAGGG3’
Using PCR, you want to amplify a DNA fragment that has the terminal sequences shown below: 5'-GATTACAATAGGAATTC~~~~~~~ ~~~~~~GAATTCTCGTGACTCCG-3' 3'-CTAATGTTATCCTTAAG~~ ~~CTTAAGAGCACTGAGGC-5' Which of the following pairs of primers would amplify this fragment? (Hint: Sequence and orientation are relevant considerations). O None of these sequences O 5'-GATTACA-3' and 5'-GCCTCAG-3' O 5'-GATTACA-3' and 5'-CGGAGTC-3' O 5'-CTAATGT-3' and 5'-CGGAGTC-3' O 5'-CTAATGT-3' and 5'-GCCTCAG-3'