Q: Briefly discuss Mendelian Inheritance with that of crossing-over.
A: The Mendelian genetics gives us idea about the inheritance of genetic materials from the parents to…
Q: All of the following are muscles that control movements of the eyeball EXCEPT the O A orbicularis…
A: 1) movement of the eyeball is controlled by six extraocular muscles and these are the following:…
Q: Optimal DNA replication requires the coordinated effort of all the following EXCEPT: A single strand…
A: Single stranded binding proteins prevent single stranded DNA from exonuclease activity during…
Q: Spongy bones do not have a haversian system. a) False b) True
A: Introduction - Compact bone is more dense and lighter than spongy (cancellous) bone. Plates…
Q: Compare and contrast exons and introns
A: Introduction - Noncoding regions of an RNA transcript or the DNA encoding it that are spliced off…
Q: What is the difference between the concepts of karyotype and genome?
A: Karyotype refers to an individual's shape, size, banding patterns, and number of chromosomes. The…
Q: Which of the following is false when considering the CCR5Δ32 mutation? a) The mutation prevents the…
A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying…
Q: 19. Assess whether the following hypotheses are testable or not. Identify the premise and prediction…
A: gamete is an egg cell (female gamete) or a sperm (male gamete).
Q: A cross between plants having seed character RRY (round, green) and rrYY (wrinkled, yellow) will…
A: A Dihybrid cross is a cross between two individuals with two different traits. These two different…
Q: What is mitosis? What is the importance of mitosis?
A: Cell division is a type of splitting phenomenon takes place inside the cell in which parent cell…
Q: ___ refers to the collection of all alleles across all gene loci in a population. a) Genetic drift…
A: Introduction :- An allele is a variant form of a gene. It is found on a certain chromosome at a…
Q: What is the genetics/chromosome number of Podocarpus costalis? What is the phenology and…
A: The genus Podocarpus sensu latissimo (s.l.) was initially subdivided into eight sections. these…
Q: Question 8 Why is replication called semi-conservative? A not all leading strands are conserved B…
A: During DNA duplication, is the method to copy DNA stands when new cells are formed.
Q: mitosis
A:
Q: In terms of feeding strategies, do you think a large priapulid is more efficient than a small one?…
A: Priapulid are referred to as penis worms because of their structural morphology similar to the male…
Q: Biology When both parents are heterozygous carriers of the recessive allele that causes albinism,…
A: Drew Binsky - World's Most Famous Albino
Q: According to the book Crawford, Dorothy H. Viruses: A Very Short Introduction, did the author…
A: Yes,Author Dorothy H.writes the book excellent ,that includes all the information related to virus…
Q: In cell growth, how does the normal allele of BRCA1 work? Is it an oncogene or a tumor suppressor…
A: Cell growth is a very complex and orderly process in which various enzymes cell signaling pathways…
Q: Question 44 The term RNA refers to RNA. Blank 1 Blank 1 Add your answer
A: INTRODUCTION Answer to the question 44 is given below.
Q: The process of __________ usually involves modification and selectivity
A: Introduction Breeding is a type of sexual reproduction that results in formation of offspring, which…
Q: TACTGCCTCCCCATAAGAATT
A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…
Q: One of below statements are not correspond with dental caries * O Contagious disease b- Thick plaque…
A: Dental caries is a disease governed by various factors like the presence of fermentable sugar, the…
Q: Which of the following are not true regarding Jacksonian March? Electrical activity jumps from lobe…
A: Option A - Electric activity jumps from lobe to lobe. It is a false statement because seizure…
Q: I understand how nuclear factor-kB (NFKB) works in the inflammatory response but what is the…
A: NFKB is a transcription regulator that is activated by cytokines, oxidant-free radicals, ultraviolet…
Q: Match the force for evolution with its description, definition or example. This force typically…
A: Introduction Evolution is the process of a species' features changing over numerous generations…
Q: The blood corpuscles are of kinds.
A: This question is based on types of blood corpuscles in the body.
Q: what type of stem cells are found in the bone marrow and skin that go through mitosis frequently to…
A: Stem cells are unspecialized cells that has the ability to divide for indefinite periods and give…
Q: What is the root cause of internal splintering?
A: A splinter hemorrhage causes a person to have longitudinal streaks down the nails, which typically…
Q: discuss the potential role of soy phytoestrogens in cancer.
A: Plants often produce various metabolites to support their life. These primary and secondary…
Q: A Koi fish breeder wants to introduce a variety of colours in his current Koi population. In Koi,…
A: Parent's Genotypes: - Parent 1:- YyBB:- Gametes:- YB, yB Parent 2:- OOgg:- Gametes:- Og Punnett…
Q: Abacteria isolated from Yellowstone National Park is found to use the chemical methane as a food…
A: Chemotrophs are organisms whose energy source is obtained by the oxidation of inorganic…
Q: Explain why the following statement are incorrect.. rewrite them to make it correct 1) evolution is…
A: Evolution can be described as the gradual and continuous change in organisms. It is the process by…
Q: What slide preparation technique should you use for the following research goals? Briefly justify…
A: Microscope is an optical instrument which has major application in visualizing very small to…
Q: false: in humans, genes make up more than 50% of the genome.
A: Most genomes, including the human genome and those of all other cellular life forms, are made of DNA
Q: When the gene tree differs from the species tree due to the gene having great genetic variability,…
A: The genes are the main part of the DNA which helps in the regulation of the body function by the…
Q: Anaerobic respiration in humans occurs primarily in muscle cells during high- intensity exercise.…
A: Primary source of fuel in muscles is glucose, for both aerobic and anaerobic metabolism. In aerobic…
Q: Which of the following disaccharide repeats is the most stable towards hydrolysis?…
A: Hydrolytic stability is the resistance of a cured polymer material to reverting to a semisolid or…
Q: nicotinic receptors?
A: Answer :
Q: Question 22 During RNA chain elongation gyrase proceeds ahead of the transcription bubble in order…
A: DNA gyrase does the indispensable job of catalyzing the ATP dependent negative supercoiling of…
Q: Match the column I with column II and select the correct option. Column- Column- II a. Ovule (i)…
A: Ovary is an organ in the female reproductive system of both plants and animals. It is the organ in…
Q: 3. Compute for the amount of each component of KCN broth if you were to prepare 280 ml. Express your…
A: We are given the amount of each component present in liter of the culture. 3 g of Polypeptone is in…
Q: anaerobic fates of pyruvate (conversion to lactate or ethanol) in terms of ATP production?
A:
Q: What aminos acid would the anticodon GAC be translated into?
A: * DNA will have four nucleotides Adenine Guanine Cytosine Thymine * RNA will have four…
Q: Question 5 Which of the following distinguishes a DNA from an RNA? O Presence of a GC base pair in…
A: Uracil helps in many synthesis by acting as a allosteric regulator and co enzyme in many synthetic…
Q: A mutation produces a new beneficial dominant allele. Which of the following statements is false…
A: Mutation Any changes in the DNA from its originality is known as mutation.
Q: Which of the stated relationships is correct? A. the heart is inferior to the clavicle B. the…
A: Introduction Proximal means close to or near the trunk or the origin of a part (example, the…
Q: what are the steps in cellular organelles?
A: Organelles are the small structures within the cytoplasm that carry out functions necessary to…
Q: Name the food value mainly got by feeding on root tubers
A: Roots and tuber crops are major agricultural staple energy sources in tropical portions of the…
Q: Q4.5. Why do neurons generate an action potential, instead of simply relying on the opening of ion…
A:
Q: Calculate the coliform concentration in a milk sample based on the following colony counts: 10 2 :…
A: Introduction Coliform bacteria are defined as rod-shaped Gram-negative non-spore forming and motile…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
answers above are partially correct, but more are missing. im confused on which one of the others are correct.
- Which of the following reaction pathways is not part of the second stage of aerobic respiration? a. electron transfer phosphorylation b. acetyl-CoA formation c. Krebs cycle d. glycolysis e. a and dWhich of the following is not produced by an animal muscle cell operating under anaerobic conditions? a. heat d. ATP b. pyruvate e. lactate c. PGAL f. oxygenWhich is the correct link between conformation of the beta-subunit of the F1 component of the ATP synthase and ADP+P¡ or ATP? loose Binding Change Mechanism binding ATP ADP+P ATP Crepeat ADP ADP +P; ATP ATP +P; tight binding open ATP loose => binding ADP+Pi open => catalyzes ADP+P¡ into ATP tight => releases ATP open => releases ADP+P¡
- Glycolysis and Krebs cycle pror TWGPalygXphYW9-zKh7Bt-bdNc75nprw176dBUWOA mResponse 23. Select the situation that will NOT happen if ATP synthase is not functioning. O A. Damage to the chemiosmosis process. B. The number of ATP produced is reduced. C. ATP can be produced through oxidative phosphorylation. D. Accumulation of proton ions in the intercellular membrane. 24. Oxidation of organic compounds that produced carbon dioxide, water and release of free energy causing reduction of the final acceptor molecule: oxygen. Justify the reason. ray bonds than those inThe image below shows part of a key catabolic pathway. If an individual had a deficiency for the enzyme required at point "X", would they still be able to produce a high rate of ATP during very strenuous exercise? ATP in Glucose Prep. phase Payoff phase ļ - MacRoc Pyruvate →→→ Anaerobic fate of pyruvate ATP out ▬OD OF 1- HP 01 -- Select one: O a. No, because NAD* will not be regenerated by lactate dehydrogenase. The reduction of NAD+ to NADH is a required step during the payoff phase of glycolysis. O b. No, because lactate dehydrogenase is required for the continued recycling of NAD+ to NADH, thus allowing glycolysis to continue. Oc. Yes, because pyruvate dehydrogenase is necessary to produce acetyl-CoA, which under these conditions will feed into the citric acid cycle. Od. Yes, because this enzyme is responsible for the substrate-level phosphorylation necessary to maintain the ATP input for the preparatory phase of glycolysis. DE Report question issue Notes + 14:12 ( CEWhich of the following regarding the ATP Synthase is INCORRECT? Protons flow through the a and c subunits The translocation of four protons through the ATP synthase fuels the synthesis of one ATP molecule The F1 domain can function as an ATPase The y subunit rotates while the xß dimers are stationary
- Which of the following statements about the aerobic respiration of a molecule of glucose is FALSE? O It requires pathways and membrane complexes in both the cytosol and mitochondria in eukaryotes. O 34 molecules of ATP are generated by oxidative phosphorylation. O It requires pathways and membrane complexes in the cytosol and plasma membrane in prokaryotes. O It can generate 38 molecules of ATP in prokaryotes. O 12 molecules of ATP are generated by substrate-level phosphorylation.Choose all of the following true statements. Hint: 6 statements are true. □ If an electron moves from an atom of higher electronegativity to an atom with lower electronegativity, energy is released. O Glycolysis occurs with or without oxygen present. Other biomolecules such as lipids, disaccharides, and proteins can enter the biochemical pathway of aerobic respiration just not directly into the first step of glycolysis. Molecules other than glucose can be broken down and used to build up ATP in aerobic respiration. Glycolysis occurs during both alcohol and lactic acid fermentation, producing 2 net ATP. The higher the electronegativity of an atom, the tighter it holds an electron and the lower its potential energy. Water is the final electron acceptor of the ETC in aerobic respiration. Each protein component of the ETC in aerobic respiration is more electronegative than the last.Choose any/all that apply to the proton-motive force and ATP synthesis. The active pumping of protons through ATP synthase against their concentration gradient provides the energy needed for ATP synthesis. Rotation of the y subunit creates conformational changes in the active sites of ATP synthase that drive the release of ATP from the enzyme. Each 3 subunit of ATP synthase has a distinct amino acid sequence that accounts for the three different active sites present in the enzyme. The ATP molecules produced from the pair of electrons provided by NADH have greater potential energy than the ATP molecules produced from the pair of electrons provided by FADH₂. Inhibition of either ATP synthase or ATP translocase will stop flux through the electron- transport chain.
- Multiple Choice: A. Glycolysis “uses” ATP by: Reducing CO2 Substrate-level phosphorylation Anabolism Oxidative phosphorylation B. Labels glucose for glycogenesis. GTP ATP CTP UTP C. The enzymes involved in the anaerobic reactions of pyruvate are (naka checkbox, so pwede more than one it answer) Releases energy by producing ATP Coenzymes act as oxidizing agents for the oxidation of metabolites Examples are glycolysis, PPP, & photosynthesis Breakdown of larger molecules into smaller onesStep 1. Draw five big boxes in a line down the middle of your page along a vertical axis. (see the template attached HERE (doc) or HERE (pdf) for help. Step 1 is done for you as an example) Step 2: Write 1) Glycolysis, 2) Pyruvate Oxidation, 3) Citric Acid Cycle, 4) Electron Transport Chain, and 5) Chemiosmosis (in this order) inside these five boxes. Below each process name write WHERE in the cell it occurs. Step 3: Draw arrows going in and out of each box. Write IN and OUT on above the arrows. Each box represent multistep processes but you are focusing only on the INPUTS and OUTPUTS. Step 4. Now write down ALL the inputs and outputs of each step. Step 5: CIRCLE the carbon input and output. For example glucose is the carbon input for glycolysis while pyruvate is the carbon output of glycolysis. Step 6: Draw a BOX around where the electrons are at the end of each step. For example, at the end of glycolysis electrons are in Pyruvate and NADH. Step 7: Highlight what the energy came in as…Choose any/all that apply to the proton-motive force and ATP synthesis. The active pumping of protons through ATP synthase against their concentration gradient provides the energy needed for ATP synthesis. The ATP molecules produced from the pair of electrons provided by NADH have greater potential energy than the ATP molecules produced from the pair of electrons provided by FADH2. Each Beta subunit of ATP synthase has a distinct amino acid sequence that accounts for the three different active sites present in the enzyme. Rotation of the Y subunit creates conformational changes in the active sites of ATP synthase that drive the release of ATP from the enzyme. Inhibition of either ATP synthase or ATP translocase will stop flux through the electron-transport chain.