Analyse and interpret the SCAM data in Fig. 1, and make a table (remember to include a legend) to indicate where each amino acid is located (cytoplasm, membrane, periplasm).
Q: s) In two experiments carried out in a research lab, an enzyme reaction is run with and without an…
A: Enzymes are proteins that catalyze biochemical reactions. They contain an active site where the…
Q: ATP Hydrolysis: ATP to ADP+Pi Given that the standard free energy change of ATP hydrolysis is…
A: The mathematical relation between actual free energy change (ΔG) and biochemical standard free…
Q: Genetics Q3
A: The objective of this question is to identify the recombinant offspring and calculate the…
Q: Genetics Question 4 How would I do this with multiple punnet squares?
A: The objective of the question is to understand how to use multiple Punnett squares to solve…
Q: You are studying how your Lys-Val-Thr tripep de interacts with another pep de, which places an Asp…
A: Eventhough all ionizable groups have their characteristic pKa value, the pKa value of an ionizable…
Q: Given below is the mRNA sequence that encodes the amino acids of a protein. Based on the mRNA…
A: ● To figure out the protein sequence from mRNA sequence we need to use a codon table where 3 bases…
Q: To track cell growth and utilization of the limiting substrate in a bioreactor, the yield is…
A: S=Y(X0−S0)X−X0+S0Explanation:Lag Phase: The growth rate is zero (μ = 0) since there is no…
Q: Question 7
A: The question is asking about the capabilities of stem cells, specifically whether they can divide,…
Q: An engineered ligand binds its target with 5 nM affinity at high pH. However, protonation of a…
A: An engineered ligand (L) binds to a target protein (T) to form a ligand:target complex (LT). The…
Q: Question 1: Look at table 17.2 to see the standard free energy changes for the steps in the CAC.…
A: Citric acid cycle is also called tricarboxylic acid cycle or TCA cycle or Krebs cycle. This is the…
Q: Which of the following amino acid groups has the least propensity to be present in a beta turn?…
A: Amino acids are the biomolecule that forms protein. There are 20 amino acids, having same basic…
Q: Draw the amino acid below in its most protonated form, any intermediately protonated forms, and its…
A: pH = 1/Log [H+] If [H+] concentration in a solution is high, pH will be low and the solution is…
Q: An incomplete structure of a porphyrin ring is shown below. The structure is missing three pi bonds…
A: Porphyrin molecules are a popular biological moiety with applications in pharmaceutical chemistry,…
Q: Calculate the percentage of the peptides synthesized that will be full length and have the correct…
A: The effectiveness of each step i.e. adding of an amino acid residue in Merrifield solid phase…
Q: Question 2 Listen The ABO gene is on a different chromosome from the +/- (Rh factor) gene. What…
A: The objective of the question is to determine the correct genetic designation for a person with O…
Q: Onlyqno3 solve. I. Given a polypeptide below, answer the following questions:…
A: Proteins are polymers of amino acid residues linked together via peptide bonds and folded into a…
Q: After running a qPCR experiment, we will have graphs showing the amount of fluorescence detected by…
A: The Polymerase Chain Reaction is a qualitative procedure which is used to produce large copies of…
Q: Produces Leaves the nucleus and goes to the... 7. Transcription and Translation---DNA: A A…
A: Piece's of RNA make amino acids, which make proteins and this process occurs in the Cytoplasm. m RNA…
Q: Rate in U [S] in mM No Inhibitor 0.5 1.0 2.0 4.0 8.0 16.0 32.0 64.0 0.22 0.41 0.73 1.12 1.57 2.01…
A: The Michaelis-Menten kinetics is the simplest and best model to understand enzyme kinetics, and it…
Q: 2. What is a checkpoint? Give an example and say what happens at that checkpoint.
A: The objective of this question is to understand the concept of a checkpoint in the context of…
Q: Choose the False statement about the parameters that quantitate enzyme catalysis A. V max is the…
A: Enzymes are biological catalysts that increase the rate of biochemical reactions.Most enzymes are…
Q: 7. Do Km and Vmax get affected by available substrate concentration? Explain.
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: The data in the table are used to create a calibration curve for the determination of RNA from ts…
A: The 'least square method' is an alternate name for the linear regression model of statistical…
Q: Assume that an enzyme-catalyzed reaction follows the scheme shown: E + S ES E + P k₁ = 1 x 10%/M-s…
A: Michaelis Menten postulated that free enzyme reacts with the substrate reversibly to form an…
Q: -OH + HO + H2O + CO2
A:
Q: Please describe what is a peptide bond? What is the significance of the amino terminus versus the…
A: Proteins are biomolecules which show great diversity in their structure and functions with Amino…
Q: 22. For the process, A B, Keq is 0.02 at 37°C. For the process, BC, Keq 1000 at 37°C. A. Determine…
A: The objective of the question is to determine the equilibrium constant for the overall process A…
Q: Draw a mechanism to account for the inter-strand cross linkage of two guanines by busulfan. Explain…
A: Busulfan is a drug used to treat cancer. It can form inter-strand crosslinks between guanine species…
Q: Directions: Answer the following as directed: vinu oto de 00 200nsko2 brs 2nA lo epello 1. After…
A: Amino acids are building blocks of proteins, which have three different chemical groups: an amino…
Q: How many dissociable protons are present in Tris buffer? How did you come to this conclusion?…
A: Tris buffer is also known as tris(hydroxymethyl)aminomethane. It is an organic compound with the…
Q: Q5. A sh mutant called shXS is isolated that produces a truncated polypeptide of only 6 AAs in…
A: The objective of the first question is to identify a single basepair DNA change that would lead to a…
Q: a particular enzyme catalyzes a single reactant S to a single product P, following michaelis-menten…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: BME (high concentration) disrupts O Disulfide linkages Accelerating disulfide cross-linking. Olonic…
A: BME stands for beta-mercaptoethanol. It is a chemical compound. It can act as a biological…
Q: Exercise 10 & 11: Carbohydrate catabolism in general - primarily looking at fermentation paths in…
A: Catabolism and anabolism are two fundamental processes involved in the metabolism of organic…
Q: D raw the full structure of the following tetrapeptide . Label the N terminal and C terminal…
A: An amino acid is a biomolecule that has a hydrogen atom, an amino group, a carboxyl group and a…
Q: A patient suffers severe tachycardia upon consuming even a small amount of alcohol. What enzymatic…
A: Tachycardia is defined as the increased heart rate which is characterised by more than 100 beats per…
Q: Along the pathway shown belour for a reaution when Est represents on enzyme bound transition state,…
A: The state that is attained by the substrates through a molecular arrangement during a reaction. This…
Q: In the following graph, enter the number of the curve that corresponds to each of the following…
A: Enzyme inhibition occurs when certain substances also called inhibitors, bind to and inactivate…
Q: How many TCA cycles required to fully oxidize 1 molecule Acetyl-CoA. Support your answer with…
A: There are two oxidizable carbons in acetyl-CoA; the methyl carbon (CH3-) and the carbonyl carbon…
Q: Imagine a typical enzyme kinetic curve of [S] vs. V. The maximum [S] is about four times the Km.…
A: 1. Vmax: A parameter in enzyme kinetics, maximum velocity, or Vmax for short, is the fastest rate at…
Q: When the CAC is run in reverse by microorganisms that use it to fix carbon, the citrate synthase…
A: Kreb cycle is the reaction procews that operates in the mitochondria and it is followed by…
Q: Fill in the table below Monomeric units are called: What are unique monomeric units? Linkages…
A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…
Q: Question 5 Listen In cats, Short Hair (S) is dominant to long hair, Black fur (C) is dominant to…
A: The objective of this question is to determine the probability of a specific genetic outcome based…
Q: 6. Malate dehydrogenase catalyzes the following reversible reaction: NAD+ NADH + H* IZI malate…
A: Biological oxidation-reduction reactions or redox reactions involve the transfer of electrons from…
Q: Dihybrid Cross 13 Problem 5: A SsYy x ssyy test cross. Which of the following genotypes would you…
A: The objective of this question is to determine which genotype would not be expected in the offspring…
Q: II. Analysis. Given below is a schematic diagram for a simple analysis of a novel tetrasaccharide…
A: Benedicts test : This is the biochemical test that is used to identify the presence of reducing…
Q: Why is it that the carboxylate "ions" actually partake in the citric acid cycle ratherthan the…
A: The regeneration of oxaloacetate from citrate is called the citric acid cycle. It occurs in the…
Q: 27. The standard-state free energy of hydrolysis for acetyl phosphate in 1,3-Bisphosphoglycerate is…
A: Gibbs free energy charge () is function of standard Gibbs free energy (), temperature (T), universal…
Q: Organic compounds are those substances composed of atoms of a single element. containing chains and…
A: Organic molecules are found in the tissues of animals, plants, bacteria, and fungi; they are also…
Q: 2) You are studying the tripeptide Lys-Val-Thr. a) Draw the full structure of the tripeptide…
A: Pepetides are composed of amino acids. Amino acids are biomolecules where a carbon atom (called…
Analyse and interpret the SCAM data in Fig. 1, and make a table (remember to include a legend) to indicate where each amino acid is located (cytoplasm, membrane, periplasm).
Step by step
Solved in 4 steps with 2 images
- BL1250 Group activity 4 2020 (1) – Saved to my Mac v Mailings Review View Tell me EXERCISE 4 QUESTIONS 1. TRANSCRIPTION: Much research effort has been invested in understanding how transcription is regulated, because this process is very important for determining cell function. Transcription is a major on/ off switch for genes, providing the instructions for translation and determining the types and amounts of proteins made in a cell at a specific time. The Zebrafish is a model organism for research, and many biologists study how the regulation of genes affects the development of the zebrafish embryo. The effects of a variety of experimental conditions on zebrafish embryos can be easily visualized by light microscopy, because the outer covering (chorion) and the embryo are both transparent. See an images of zebrafish embryos at different time points in development and the adult form below. 0h Os 0.75 h 2h 3.25 h 8 h 16 h 24 h 72 h Adult -3 months (not to scale) Image from:…b. Which one of the following a cell mutants will be able to switch at least once? [Select]LS1-1 Which of the following best represents the amino acid sequence found in normal adults with the HBB gene? O His, Gly, Asp, Gly, Gin, Leu, Leu Val, His, Leu, Thr, Pro, Glu, Glu O Val, Gly, Asp, Thr, Pro, Glu, Glu O Leu, Glu, Asp, Gly, Gin, Leu, Leu
- 1117 increase in the number of passive glucose transporter on the muscle cell surface thus increases the uptake of glucose into the cell and decreases blood glucose level. Indicate whether the following conditions/practice will likely lead to diabetes (mark Yes or No). [Select] a mutation in a V-SNARE in islet cells that blocks all secretion Q Search ******* 40 ****** 99+ app.honorlock.com is CIn Figure 9-12(b), what do you think happens to thetRNA that is released from the E site?Draw a hairpin structure like that shown in Figure 18.5 for the repeated sequence found in fragile-X syndrome (see Table 18.1).
- You have discovered a family with a new genetic form of anemia. The DNA sequences at the 5’ end of the non-template strand of the normal and mutant DNA encoding the alpha subunit of hemoglobin are given below: Normal 5’-ACGTTATGCCGTACTGCCAGCTAACTGCTAAAGAACAATTA…..-3’ Mutant 5’-ACGTTATGCCCGTACTGCCAGCTAACTGCTAAAGAACAATTA….-3’ What are the amino acid sequences of the normal and mutantpolypeptides?You have discovered a family with a new genetic form of anemia. The DNA sequences at the 5’ end of the non-template strand of the normal and mutant DNA encoding the alpha subunit of hemoglobin are given below: Normal 5’-ACGTTATGCCGTACTGCCAGCTAACTGCTAAAGAACAATTA…..-3’ Mutant 5’-ACGTTATGCCCGTACTGCCAGCTAACTGCTAAAGAACAATTA….-3’ What are the amino acid sequences of the normal and mutantpolypeptides? What are the codons in the translated portion of the mRNA transcribed from the normal and mutant genes? What type of mutation is present in the mutant hemoglobin gene?You have discovered a family with a new genetic form of anemia. The DNA sequences at the 5’ end of the non-template strand of the normal and mutant DNA encoding the alpha subunit of hemoglobin are given below: Normal 5’-ACGTTATGCCGTACTGCCAGCTAACTGCTAAAGAACAATTA…..-3’ Mutant 5’-ACGTTATGCCCGTACTGCCAGCTAACTGCTAAAGAACAATTA….-3’ What are the codons in the translated portion of the mRNA transcribed from the normal and mutant genes?
- Given the following DNA, (A) what is the transcript (MRNA) sequence? (B) What might be the amino acid sequence of the translated protein? 5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3'2. Peter is diabetic. So the molecular biologist cloned a DNA sequence in Peter's body cells that will synthesize insulin hormone. 5' AGCTAGACGCATCCTAATG-GCC-ACT-GAA-TCC-TGAATGGACGA 3' a) What will be the RNA of this insulin gene Sequence? b) How many amino acids will be translated from this mRNA? c) Give the amino-acid sequence of insulin.What is 15q?