An x-ray photon is: O A small particle able to penetrate matter A bundle of energy with no mass or weight O An electron that has been accelerated to 186,000 miles/second O None of the above describes an x-ray photon An electrical current that has been magnified by 1000 V or 1 kV
Q: mtDNA is Select one: a. Double stranded linear DNA molecules b. Single stranded circular DNA molecul...
A: Introduction :- Mitochondrial DNA (mtDNA) has a number of unique characteristics, such as a high cop...
Q: Explain what would happen to a red blood cell placed in a hypotonic solution. Then compare that to w...
A:
Q: The nervous system is the major controlling, regulatory, and communicating system in the body. It is...
A: Introduction Everything you do is controlled by your neurological system, including breathing, walki...
Q: In a cross between mice the genotypes AB/ab x ab/ab, what is the recombination frequency if the prog...
A: The recombination frequency is used to calculate the distance between the genes. If the genes are pr...
Q: List atleast 50 laboratory equipments or tools. Just list, no need to give the uses
A: ANSWER;- 50 laboratory is;-
Q: Can you answer all the parts to this question regarding fish (please type the answer) Mammals hav...
A: Fish gills use a design called ‘countercurrent oxygen exchange’ to maximize the amount of oxygen tha...
Q: A space probe returns from Mars where it has collected a new microorganism. It has double- stranded ...
A: Introduction: DNA replication is the basis of biological inheritance in all living beings. The proce...
Q: In the diagram below, the letter B represents: d. a The substrate specific for the enzyme The active...
A:
Q: When you add new tRNAs, what happens to the green amino acids they carry at the top of each tRNA?
A: In any cell the DNA ultimately form functional protein and for this every cell form a process called...
Q: --TGT(G/C)CAG------3'
A: SNV means single nucleotide variants on individual RNA molecules To identify genomic differences we ...
Q: Expansins are activated by acidic conditions that modify the Select one: a. Hydrogen bonds between p...
A: Expansins are loosening proteins that function as loosening activity of plant cell walls.
Q: What are the importance of nitrogen and potassium in plants?
A: Plants need various nutrients in form of biomolecules for its activities , these elements are divide...
Q: How does application of recombinant DNA influenced the way in today's life? Answer comprehensively
A: Recombinant DNA technology is an important development in science that has made human life much easi...
Q: QUESTION 4 The hormone erythropoietin can improve athletic performance by: Increasing the function o...
A: Erythropoietin (EPO) is commonly used by athletes as a dope hormone to increase their performance. E...
Q: 1999 Question #2 Communication occurs among the cells in a multicellular organism. Choose three of t...
A: Introduction The cell is life's most fundamental structural and functional unit. Cells are the build...
Q: What is the function of DnaB, one of the three special proteins needed to form the initial replicati...
A: The replication process begins with the unwinding of the polynucleotide strand, which forms a replic...
Q: During the third step of PCR, Taq polymerase adds nucleotides to the growing DNA segments. Why is Ta...
A: Polymerase chain reaction i.e PCR is a molecular technique which is used to make multiple of the fra...
Q: A region of the genome is amplified by PCR to analyze two closely linked SNPs. PCR products from ind...
A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA (deoxyr...
Q: Specify the correct number of chromosomes and chromatids in each of the following human cell types. ...
A: Introduction: When a cell prepares for division, It makes a new copy of the DNA. The one half of th...
Q: Data for two populations are shown below in Figs (a) and (b), respectively. The slopes of the best f...
A: ANSWER;- Correct answer is a,d,e
Q: Fill in the blanks in each sentence below after re-reading the section on Osmosis and Tonicity. Osmo...
A: Introduction :- The spontaneous net movement or diffusion of solvent molecules through a selectively...
Q: the processing of pre-mRNA in eukaryotes Select one: a. Exons are joined together using polyadenylat...
A: In Prokaryotes; both Transcription and translation process takes place in the cytoplasm; but in euka...
Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)...
A: Central Dogma: It is the complete procedure of replication, transcription, and translation of DNA. T...
Q: Questions: 1- Name the different type of dialyzers. 2- What is relationship between hollow fiber por...
A: 1... Types of dialyzers cellulose triacetate (CTA), ethylene-vinyl alcohol co-polymer (EVOH), polyes...
Q: 1. The two major reasons that a cell undergoes mitosis is: and 2. a. What is one major difference be...
A: Mitosis is the cellular division that forms two daughter cells. These cells are identical to the mot...
Q: 3._In the first step of ethanol formation, a carboxyl group is removed from pyruvate and released in...
A: Answer 1- in first step if ethanol formation, a carboxyl group is removed from pyruvate and released...
Q: Explain the purpose of the regulations on DNA technology. (Give 4 points)
A: Purpose Of The Regulation On DNA Technology --- Biotechnology -- Advancement in the technology is ve...
Q: The pka of pyruvic acid is 2.50, and itconjugate base is pyruvate. Which form, pyruvic acid or pyruv...
A: Introduction Pyruvic acid is a type of organic acid that is found in almost all living cells. It ion...
Q: A reversible non-competitive inhibitor binds reversibly at a site other than the active site. This b...
A: Introduction :- When an equilibrium between the enzyme and the inhibitory medication can be formed, ...
Q: Where is the cytoplasm located in the anabaena and is the cytoplasm interconnected?
A: Given: Anabena is a genus of nitrogen fixing cyanobacteria blue green algae. Colonies grow in filame...
Q: Identify the structures labeled a and b on the figure below. noitesinsgnO In
A: Chip budding is a grafting technique. A chip of wood containing a bud is cut out of scion with desir...
Q: Study the following scenario. Plot the 5-day menstrual dates in the calendar provided in the activit...
A: Menstruation is a 3-5-day period in which a bloody fluid containing endometrial cells, glandular sec...
Q: A cation channel blocker is injected into a single olfactory neuron in a rat. When exposed to the co...
A: Olfactory neurons are bipolar neurons adapted for peripheral odorant signal transduction and transmi...
Q: Why are fungal infections not easy to treat in humans and animals? answer the following in 3-6 sent...
A: INTRODUCTION In the environment, the fungi may cause various diseases in humans and animals. F...
Q: Assume that a single gene determines coat coloration in cats, with the B allele resulting in orange ...
A: A. What is the probability that Hobbes and Pepper have three kittens, Hopper (male), Pepsi (female),...
Q: Explain in detail Structure , reproduction and life cycle of mucor .
A: Structure:- Mucor's vegetative structure:- Multicellular fungi, such as Mucor, are organized into ...
Q: If Individual 5 mates with a homozygous recessive horse, which of the following is a valid predictio...
A: Achondroplasia as mention is an autosomal dominant trait, thus confirming that the genotype of indiv...
Q: A new enzyme (protein) that helps protect a bacterial cell from reactive oxygen species (causing oxi...
A: INTRODUCTION Bacterial growth curve Represents number of living cells in a bacterial population over...
Q: In many viral diseases (e.g., smallpox, mumps and influenza), illness occurs shortly after exposure ...
A: A virus is a combination of hereditary code, either DNA (deoxyribonucleic acid) or RNA (ribonucleic ...
Q: Which of the following gives the correct pathway for food as it moves through the digestive system? ...
A: The process of converting complex food substances to simple absorbable forms is called digestion and...
Q: Explain how do humans receive odors and scents,experience flavors, and experience pain and tickling ...
A: The feelings of smell and taste are related in fact, the two of them utilize similar sorts of recept...
Q: Restate Liebig’s Law of Minimum to include conditions/ factors in these present times. Explain your ...
A: Liebig's Law of the Minimum states that yield is proportional to the amount of the most limiting nut...
Q: 4. What are some ways on how your body regulates the increase in temperature, heart rate, and respir...
A: Homeostasis -- Different physiological strategies are maintain the proper functioning of a system in...
Q: After a long excursion in the tropics you came back with multiple soil samples from different local...
A: ISOLATION OF ANTIBIOTIC PRODUCING FUNGI FROM DIFFERENT SOIL SAMPLE: 1.COLLECTION OF SAMLPLE: soil ...
Q: Which of the following statements about carbohydrates intake is TRUE? A. The whole grain bread has h...
A: The carbohydrates are found in a wide exhibit of both healthy and undesirable food varieties bread, ...
Q: Mr. Jones Mrs. Jones Color blind Homozygous for normal vision Color blind Normal vision Carl Dale In...
A: Color blindness is a well-known term that they are usually defined as a hereditary disorder caused b...
Q: Why are lymphoid tissues associated with the gastrointestinal tract and respiratory tissues?
A: Introduction :- Lymphoid tissues are well-organized tissues that help the immune system function. Pr...
Q: What are some research-able questions about the Corona Virus?
A: Some research able questions about corona virus are listed below
Q: Organic monomers joined to form organic polymers is the stage number evolutionary biologists. of the...
A: Origin of life: Stanley L. Muller and Harold C. Urey first conducted the experiment to show origin o...
Q: label thymus gland under miscrocope picture below
A: Thymus Gland: The immune system's thymus is a specialised main lymphoid organ. Thymus cell lymphocyt...
Photons are the tiniest packets of electromagnetic energy and it includes light or radio waves. It travels at the speed of light.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Which of the following types of photons (packets of pure electromagnetic energy) have the highest energy level? visible light infrared microwaves ultra-violetIn a vacuum, all electromagnetic waves have the same speed. frequency O wavelength. O amplitude.Given the chromatogram below in a normal phase, which samples would be the most polar? A O Samples Cand D O Samples B and X O Samples B and C O Samples A and D
- The patlents described In the table below just checked in to the Alex Py Memorlal Hospital & Regional Medical Center. Which are headed to the Department of Nuclear Medicine for a radioimaging procedure? Which are headed to the same place for a brachytherapy procedure? procedure patlent O brachytherapy Rachel is taking part in a research study almed at understanding how the brain recovers from a stroke. Today she is scheduled for a PET (Positron Emission Tomography) scan that will map out the blood flow through her brain so it can be compared to the result of PET scans taken earlier in her recovery. O radioimaging O neither O brachytherapy Kelsha is being treated for cervical cancer. After surgery to remove the tumor, her oncologist recommended the placement of radioactive iridium-192 wires near the tumor site to kill any remaining cancer cells, for 15 minutes at time, 2 days a week, for 4 weeks. Today she arrives for her final treatment session. O radioimaging O neither O brachytherapy…Which of the following method is employed in the sample preparation for the cryo-electron microscope? O The sample is flash-frozen in water to form crystalline ice O The sample is embedded, sectioned and then stained with a negative stain then flash-frozen in water to form vitreous or amorphous ice The sample is flash-frozen in water to form vitreous or amorphous ice The sample is embedded, sectioned and then stained with a negative stain then flash-frozen in water to form crystalline iceWhich factor makes the biggest difference when studying the effects of radiation on an organism? O the number of cells exposed to the radiation the frequency of the radiation O the size of the organism O the duration of exposure
- please wich type of x rays could reach inside human body (ie lungs)the energy of 5 mJ/cm2 preferably wavelenght of 150 nm approx and time exposure necessary to reach this level is this energy it in the range of usual x rays used in medicine for diagnosis or therapy ?on Select the correct statement from the following option: O a. Spectroscopic methods require less time and more amount of sample than classical methods O b. Spectroscopic methods require more time and more amount of sample than classical methods cof O c. Spectroscopic methods require less time and less amount of sample than classical methods O d. The results obtained by spectroscopic methods are less rellable, less reproducible and incorrect than classical methods O . Spectroscopic methods require more time and less amount of sample than classical methodsA solution containing two different fluorescent compounds, Ben and Jerry, were analyzed for their individual concentrations in the mixture. Standards of pure Ben and pure Jerry were prepared at a concentration of 500.0 mM and were run in a UV-Vis Spectrophotometer to determine their absorption properties. Absorbance Wavelength Compound Ben 500 mM Compound Jerry 500 mM 400 nm 0.137 0.136 450 nm 0.312 0.113 500 nm 0.154 0.078 550 nm 0.076 0.079 600 nm 0.227 0.148 650 nm 0.230 0.230 700 nm 0.151 0.357 750 nm 0.157 0.246 800 nm 0.154 0.154 A standard curve of the standards was also prepared to help determine the concentration of each component in the solution. The solution produced an absorbance reading of 0.486 at the Amax of Ben, and 0.463 at the Amax of Jerry. STD CURVE BEN Amax Ben Amax Jerry STD CURVE JERRY Amax Ben Amax Jerry CONC (mM) ABS ABS CONC (mM) ABS ABS 100 0.074 0.025 100 0.037 0.074 200 0.148 0.057 200 0.081 0.148 400 0.284 0.103 400 0.164 0.284 800 0.607 0.218 800 0.287…
- Polonium is a rare element with 33 radioisotopes. The most common one, P210o, has 84 protons and 126 neutrons. When P210o decays, it emits an alpha particle, which is a helium nucleus 2 protons and 2 neutrons. P210o decay is tricky to detect because alpha particles do not carry very much energy compared to other forms of radiation. For example, they can be stopped by a single sheet of paper or a few inches of air. That is one reason why authorities failed to discover toxic amounts of P210o in the body of former KGB agent Alexander Litvinenko until after he died suddenly and mysteriously in 2006. What element does an atom of P210o change into after it emits an alpha particle.A chemistry student at GGC synthesized a new sulfonamide (S7) drug to help treat malaria. Using a spectrophotometer the student observed that S7 converts to a colorless molecule in the presence of malaria parasite called Plasmodium falciparum. To study the rate of reaction, the student recorded the absorbance/amount of S7 at a wavelength of 570 nm. The results are summarized in the table below: Time (s) Absorbance/Amount of S7 0.80 0.63 10 0.50 15 0.40 20 О.32 25 0.25 30 0.20 Determine the half-life of S7. Include units in your answer MacBook Air 000 000 F8 80 F7Imagine you are using a microscope with 5x eye pieces (instead of 10x like ours). If you change from the 10x objective lens to the 40x objective lens, how does the total magnification change? O it is 30 units stronger O it is 4 times weaker with the 40x it is 5 times weaker with the 40x it is 30 units weaker O it is 5 times stronger with the 40x O it is 4 times stronger with the 40x 99+ 近