ACTIVITY 7.1.2 Write the structural formula of dATP, DTTP, DCTP, dGTP, UTP, and give the complete name for each.
Q: Basal Metabolic Rate (BMR) depend - on All Size of body O Mass of body O
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any sp...
Q: The order of elution of amino acids X, Y, VW and Z in a cation exchanger eluted with a buffer of inc...
A: Ion exchange chromatography is used to separate molecules based on the charge. In the ion exchange c...
Q: 6. Why would the lack of lactase cause Carol so much distress? Where would the undigested lactose tr...
A: Lactose is the principle carbohydrate present in milk and consists of two sugars, glucose and galact...
Q: Disulfide bridges are limited in that only one particular amino acid can form these types of interac...
A: Disulfide bonds are a second post-translational alteration found only in ER proteins. The presence o...
Q: In general, proteins can be classified into 3 different groups. Name and give a short description of...
A: Proteins are considered as large biomolecules and also a macromolecules which comprise one or more l...
Q: Given the chromatogram below in a normal phase, which samples would be the least polar? O Samples Ba...
A: In chromatography, for comparing relative polarity of the molecules, the retardation factor (Rf) ca...
Q: What are the 5 major groups of the kingdom Fungi? What characteristic: distinguish the groups from o...
A: Fungi, which include yeasts, moulds, and mushrooms as well as other microbes, are eukaryotic organis...
Q: Draw a two-intron eukaryotic gene and its pre-mRNAand mRNA products. Be sure to include all the feat...
A: Introduction: Only a few RNA molecules are transcribed directly into the final mature RNA. Mostly n...
Q: 14. Subject this amino acid sequence under (1) trypsin (2) chymotrypsin (3) pepsin and (4) CNBR. Gen...
A: Protein digestion with different enzymes is specific as they cleave the peptide bond with specificit...
Q: C. Deepen (Pagpapalalim ng Kaalaman) Let us do the activity below. (50 mins. with provision for anal...
A: Transcription is the process of synthesis of mRNA from DNA. And the process of synthesis of protein ...
Q: List the systematic classification of anzymes according to then Enzyme Commission indicating the cla...
A: Enzymes are defined as the BIO CATALYST that helps in a catalyzing the reaction. Enzymes are protein...
Q: What is the difference between the two salt precipitation methods: salting in and salting out? Gro...
A: SAlting out is a method generally used in purification of molecules depending on their solubility a...
Q: Write into the given fields the nomenclature name of the given tripeptide and its sequence using one...
A: Each of the 20 naturally occurring amino acids can be denoted by a three letter code or a single let...
Q: How much ATP and CO2 can be derived from 500 g of lactose?
A: Lactose is a sugar that is found in milk. Lactase is an enzyme that helps our systems absorb sugar b...
Q: Consider the following two peptide sequences. Peptide 1): LKAENDEA ARAMSEA Peptide 2): CRAGGFPWDQPGT...
A: The amino-acids sequences have different propensities for forming secondary structures. based on the...
Q: Given a tripeptide Cys-His-Lys, Cys: Pk: = 1.71; Pk2= 10.78; Pke= 8.33 His: Pk = 1.82; Pkz= 9.17; Pk...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: Compare and contrast the formation of mRNA in bacterial and eukaryotic cells. How do the differences...
A: Gene expression is the process by which genes are turned on in a cell to form RNA and proteins. This...
Q: In size exclusion chromatography, which component will elute last in the set up? Group of answer c...
A: Size exclusion chromatography is also known as gel filtration chromatography (GFC) or gel permeation...
Q: What happens when cell division didn’t undergo or complete the Meiosis I and Meiosis II?
A: A process by which cell divide into two or more daughter cells and distributes its genetic material ...
Q: What are the factors necessary for the rapid absorption of sugars?
A: Carbohydrates are defined as the poly hydroxy aldehydes or ketones with an emperical formula CX(H2O)...
Q: Drawn below is a schematic of a transmembrane protein. AN Extracellular Cell membrane Cytosolic side...
A: Introduction: A membrane protein is a protein molecule that is connected or linked with the membran...
Q: Translocation during translation requires energy from the hydrolysis of Select one: O a. GTP O b. AT...
A: Translation is the process of formation of proteins from amino acids that are synthesized by the mRN...
Q: the role of carbohydrates in Nutrition and oral health especially its role in the formation of dent...
A: A carbohydrate is a type of biomolecule made up of carbon, hydrogen, and oxygen atoms. Carbohydrates...
Q: Using the provided data on the activity part, what is the acquired R value? Is it acceptable or not?...
A: Absorbance is the unit measure of amount of light that passes through a particular solution at a giv...
Q: но- OH он о Но- OH HO HO- OF OH ÓH HO
A: The above given structure represents Stachyose. It is a tetrasaccharide made up of four molecules. T...
Q: Calculate the net charge of the molecule at pH 3.
A: Amino acids are organic compounds with two functional group namely carboxyl and amino. Amino acids f...
Q: Give the similarities and differences of the gel filtration and isoelectric precipitation in terms o...
A: Protein Purification: Modern protein science lab and related industries overexpress target protein i...
Q: What is the meaning of proofreading activity ? O A. The polymerase checks for the correct incorporat...
A: DNA means deoxyribo nucleic acids. DNA act as genetic material in most organisms present on earth. T...
Q: Spot the difference between the chemical structures of DNA & RNA and state the said difference in a ...
A: Deoxyribo nucleic acid is abbreviated as DNA and Ribonucleic acid as RNA. They are the molecules tha...
Q: If you had a 50 mL volume of 1% agarose gel to create with appropriate amount of SYBR Gold how would...
A: Agarose gel electrophoresis is a method of gel electrophoresis that is used to separate a heterogen...
Q: Use of Microbes for Improving Food Safety and Quality Yeast Probiotics Please have a whole paragrap...
A: An eaten probiotic is a live microorganism that has a favourable effect on the prevention and treatm...
Q: Modified true or false. Write the correct answer if the underlined word is false.
A: Any organic molecule that consists of a basic amino group, an acidic carboxyl group, and a distinct ...
Q: Why was there a greater A260 absorbance reading for your DNA sample that was incubated at higher tem...
A: Hyperchromicity is the increase in optical density of a substance at a particular wavelength.
Q: Use the equation of the linear regression line fitted to your standard curve and the migration of yo...
A: Agarose gels are often run to check DNA properties in several molecular biology experiments. The giv...
Q: In Figure 8-15, what do you think would be the effect ofa G to A mutation in the first G residue of ...
A: Introduction: The term mutation refers to heritable changes in the genetic material and the individ...
Q: A) Why most therapeutic inhibitors (prescription medications) that are enzyme inhibitors function th...
A: A competitive inhibitor is any compound that bears a structural resemblance to a particular substrat...
Q: In Chapter 3, the Kd of calmodulin EF hands for binding Ca2+ is given as 10−6 M. Many proteins have ...
A: Calmodulin is a Ca2+ sensor with EF-hands as its high-affinity Ca2+ binding domains, making it a pro...
Q: Experimental results describing a protein's amino acid composition are useful for estimating the mol...
A: Proteins are biological macromolecules composed of amino acids linked together by peptide bonds. The...
Q: Make a graphical representation of activation energy and change of free energy in a reaction and com...
A: Enzymes are the substances that catalyse reactions by increasing the rate of reaction. They are usua...
Q: Phosphoglycerate mutase transfers a phosphoryl group from C3 of 3-phosphoglycerate to C2 position t...
A: Phosphoglycerate mutase transfers the phosphate group on C3 of 3-phosphoglycerate to C2, this covert...
Q: what are the key glycolytic enzymes and why are they considered key? how are these steps overcome in...
A:
Q: List the systematic classification of enzymes according to the Enzyme Commission indicating the clas...
A: A protein or RNA produced by living cells that is highly selective and catalytic to its substrates i...
Q: These types of proteins come from foods that contain all amino acids for nitrogen balance and tissue...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: Three polypeptides, the sequences of which are represented using the one-letter code for their amino...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: What biological rationale can explain why there are so few variants observed at position 65 of the h...
A: The iron atom in the heme group can form a total of 6 coordinate bonds . 4 of these are formed with ...
Q: What does an A260/A280 ratio of > 1.8 mean?
A: For the DNA sample, an absorbance spectra is obtained in which the maximum absorbance occurs at a pe...
Q: 24. Add formal charges directly to the structures. 2+ FHF -P C-Si-C H-AI-H H CI
A: Introduction: The formal charge of an atom is the charge that is calculated for an atom in a Lewis s...
Q: • In a globular protein, where would you expect the nonpolar regions to be located? Whereabouts woul...
A: Proteins are classified into two main groups based on their Molecular shape. They are 1) Globular pr...
Q: Addition of strong acid or base to a protein disrupts its disulfide bridges and electrostatic intera...
A: Protein are polymers of amino acids ,and the sequence of amino acids of protein determines protein s...
Q: Is it ethical to see a severe need for help andnot respond to it directly?
A: Firstly, we need to understand what is a severe need . It may vary from person to person . The sever...
Step by step
Solved in 2 steps with 5 images
- KIF1A has only a single motor domain. What additional structural elements would you expect to find in the KIF1A structure?In biochemical and structural terms, how does the cellular form of the prion protein differ from the infectious form? Can you also explain what is the biochemical basis for “infectiousness” of the prion protein?ACTIVITY 7.3.3 1. Given the MRNA: 5'AUGCAUGACGAUCUCGUCGCG....3' a. Use the genetic code to predict the amino acid sequence encoded by the mRNA. b. Naturally, the information in this MRNA came from DNA. Give the sequence of the sense strand of the DNA. 2. Referring to the mRNA above, a tRNA must interact with the MRNA codon CUG which codes for Leu. What will be the anticodon in the TRNA-Leu?
- ACTIVITY 7.3.3 1. Given the mRNA: 5'AUGCAUGACGAUCUCGUCGCG...3' a. Use the genetic code to predict the amino acid sequence encoded by the mRNA. b. Naturally, the information in this mRNA came from DNA. Give the sequence of the sense strand of the DNA. 2. Referring to the mRNA above, a tRNA must interact with the MRNA codon CUG which codes for Leu. What will be the anticodon in the tRNA-Leu? 153 Copyright 2019. All Rights Reserved.The following RNA: 5' AUGAUAACACUCGUACCUUAAUGU3' in the 5'-3'frame will betranslated into a peptide (use the table): Second letter A U G UAU Tyr UUC (F) UcC Ser UAC (Y) UCA (S)UAA Stop UUU Phe UCU UGU Cys UGC (Č) UUA Leu UGA Stop A UUG (L) UCG UAG Stop UGG Trp G (W) CUU CCU CAU His CGU CUC CCC Pro CÁC (H) CGC Leu САА GIn Arg CGA (R) CUA (L) A (P) CUG CCG CAG (Q) CGG AUU ACU AAU Asn AGU Ser Ile ACC (1) ACA (T) AAA AAC (N) AGC (S) AUC A AUA Thr AGA Arg Lys A AUG Met ACG (М) AAG (K) AGG (R) G GUU GAU Asp GCU GGU GCC Ala GUC Val G GUA (V) GCA (A) GAA Glu GAC (D) GGC Gly GGA (G) GUG GCG GAG (E) GGG G TLRECYH OA MITLVP Stop C OB IKVRLS MITLVP OD. First letter Third letterA heptapeptide was found to have an amino acid composition of Asp, Leu, Lys, 2 Met, Phe and Tyr. (a) Trypsin has no effect on the heptapeptide. (b) The phenyl thiohydantoin released by Edman degradation revealed phenylalanine in the N-terminus. (c) Brief chymotrypsin treatment yielded several products including a dipeptide and a tetrapeptide. The amino acid composition of the tetrapeptide was Leu, Lys, and Met. (d) Cyanogen bromide treatment yielded a dipeptide, a tetrapeptide, and free Lys. What is the amino acid sequence of this heptapeptide? Answer Format: (Three letter abbreviation with dash ie., Ala-Gly-…) *
- Answer codon usage based on this description: You have isolated a new eukaryotic microorganism and want to determine the genetic code of its mitochondria. Here are the amino acids encoded after translation of two synthetic mRNAs using mitochondrial extracts from your eukaryote- in this experiment translation can start at any sequence position: RNA: Protein: Tyr-Met-Tyr-Met-Tyr-Met---- UAUAUAUAUAUAUAU--- UAAUAAUAAUAAUAA--- Asn-Asn-Asn-Asn-Asn---- Met-Met-Met-Met-Met---- Based on the results shown here, what can you conclude about the codons in this eukaryote? A. B. C. D. O A O C OD OB AUA Tyr Met Tyr Met UAU Met Tyr Met Tyr AAU Met Trp Asn UAA Asn Asn Asn Asn, STOP or Met Asn, STOP or MetTRUE OR FALSE a) The structure of the purines and pyrimidines make them able to undergo keto-enol tautomerism. b) A unique 5'CCA terminal sequence is found in all tRNAs to be able to carry the correct amino acid to the ribosome.* REQUIRED 34. The diagram below represents one of a number of different types of mutations that can occur in DNA ....CACTAGCAG.... DNA Sequence mutation ....CACTAACAG.... DNA Sequence This mutation can best be described as the the insertion of an adenine (A) base into both strands of the DNA molecule pairing of an adenine (A) base with thymine (T) the substitution of an adenine (A) base for guanine (G) deletion of an adenine (A) base from the DNA molecule 0 1
- Given: Cryo-EM structure of PCoV_GX spike glycoprotein 1. What can you tell me about the identity of the protein? 2. What is the importance of this protein?"The native structure of hemoglobin (HB) comprises of two α and two β subunits, each of which carries a heme group. There appear to be no previous studies that report the in-vitro folding and assembly of Hb from highly unfolded α and β globin in a 'one-pot' reaction. One difficulty that has to be overcome for studies of this kind is the tendency of Hb to aggregate during refolding. This work demonstrates that denaturation of Hb in 40% acetonitrile at pH 10.0 is reversible." (J Am Soc Mass Spectrum 2007, 18, 8-16)Based on the information in the passage, the total number of heme groups present in four hemoglobin protein molecules is ________. a. 16 b. 4 c. 12 d. 8"The native structure of hemoglobin (Hb) comprises of two α and two β subunits, each of which carries a heme group. There appear to be no previous studies that report the in-vitro folding and assembly of Hb from highly unfolded α and β globin in a 'one-pot' reaction. One difficulty that has to be overcome for studies of this kind is the tendency of Hb to aggregate during refolding. This work demonstrates that denaturation of Hb in 40% acetonitrile at pH 10.0 is reversible." (J Am Soc Mass Spectrum 2007, 18, 8-16)Hemoglobin is ________.