AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene? (Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.) Submit Answer Retry Entire Group No more group attempts remain
Q: ADP molecules phosphate molecule intermembrane space ATP synthase H+ ions CoQ mitochondrial matrix…
A: A widely accepted model for ATP synthesis is the binding change mechanism or flip-flop…
Q: State those enzymes involved in tricarboxylic acid and explain each.
A: The tricarboxylic acid cycle (TCA cycle) is a common metabolic pathway located in mitochondrial…
Q: evidence of Bial's test to show a positive result for the presence of a specific sugar
A: Bial's test is a chemical test used to test for Pentose sugar. It includes chemicals like orcinol,…
Q: When weighing the protein at the end of the activity, what major assumption is made about the…
A: Casein is a protein present in milk that contributes to the white colour of the milk. Cow's milk…
Q: How do you compare and contrast the structures between protein and carbohydrates?
A: Biomolecules are carbon-based organic compounds. Biomolecules are primarily made up of carbon,…
Q: 1. One of the following is the simplest phosphoglyceride. a.Phosphatidylcholine b.Phosphatidic acid…
A: Fatty acids are important micromolecules which combine together to form lipids in plants, animals…
Q: 2. Phenothiazine derivatives (chlorpromazine, propazine, triftazine, etc.). Relationship between…
A: Phenothiazines are neuroleptic sellers that affect a selection of receptors along with dopaminergic…
Q: /hen the acetyl-CoA produced during B-oxidation in the liver exceeds the capacity of the citric acid…
A: The oxidation of some amino acids into fatty acids, as well as glycolysis, is the source of acetyl…
Q: How consuming too much dietary fat and drinking carbonated drinks affects lipid metabolism
A: Dietary fat and carbonated drink consumption have been found to be associated with several different…
Q: What is phenylketonuria? Discuss its occurrence, symptoms if any, treatments if there are, and any…
A: The pattern of inheritance of a condition caused by a recessive faulty gene copy located on an…
Q: Which process/es describe plant metabolism? O photosynthesis O Calvin cycle оо
A: The term metabolism describes all the chemical reactions involved in keeping the cells and organism…
Q: One indication of the relative importance of various ATP-producing pathways is the Vmax of certain…
A: The energy content of fat per gram is greater than that of glycogen. The tissue's ability to…
Q: body fat muscle proteins carbohydrates fiber glycogen Fasting decreases the intake of body breaks…
A: Answer Fasting decreases the intake of carbohydrates which is needed for energy. Without this the…
Q: The following plasmid is digested with EcoR1 and Ndel restriction endonucleases. Agarose…
A: Restriction endonucleases are enzymes which cleave the phosphodiester bonds within a DNA. These…
Q: Why is the formation of a peptide bond called a condensation reaction? Explain briefly
A:
Q: The reason for the decrease in the rate of enzyme reaction as the temperature is increased beyond…
A: An enzyme is a substance which serves as a catalyst in living things, governing the rate of chemical…
Q: What are two important compounds that lie at crossroads of major metabolic pathways? Select both…
A: Metabolic pathway engineering in microbial hosts for heterologous biosynthesis of commodity…
Q: A) Describe the glycosidic bond (using standard convention) indicated by “Arrow a.” B) Draw the…
A: Sterols are lipids containing a steroid nucleus and an alkyl chain. The steroid nucleus is a 4 ring…
Q: The hydrolysis of a substrate, S, by an enzyme has been studied in the lab. The following initial…
A: Consider the reaction where a substrate 'S' is converted to its product 'P' by an enzyme. The rate…
Q: For an enzymatic reaction, the following data were obtained for two different initial enzyme…
A: Enzymes are protein molecules that increase the rate of reactions by decreasing the activation…
Q: ______ 1. is the enzyme classification where lysozyme belongs ______ 2. is the name of the enzyme…
A: Note : Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…
Q: What does the last number in the numeric designation of enzymes refer to?
A: Each enzyme is allocated a four digit EC number,an enzyme Commission number does not specify enzymes…
Q: What is the diffusion coefficient of a membrane-bound protein of molar mass 79,300 daltons density…
A: Diffusion coefficient of the protein is measured as protein mass transfer with between the two…
Q: the Km of an enzyme for its substrate tends to be close to the physiological (cellular)…
A: Enzymes are the biological catalyst which to increase the rate of reaction. Km is also called as the…
Q: The lipase substrate emulsion contains 0.500 mg of olive oil per 3 mL Also, the molar mass of the…
A: The number of moles of a substance is calculated by using the equation, n=mM, where, "n" is the…
Q: The citric acid cycle occurs in the O smooth endoplasmic reticulum. mitochondrial matrix. nucleus.…
A: The TCA cycle, also known as the Krebs cycle, takes place in the mitochondria and generates a…
Q: Fill in the missing bases below to show the correct complementary base pairing. 5' 3'
A: In molecular biology Complementary base pairing or complementarity is a relation between two…
Q: 3. The overall result of glycolysis can be summarized by the equation on the right in which the…
A: Glycolysis is oxidative metabolism of glucose molecule by formation of pyruvate which enters into…
Q: What amino acid side chains can be modified by methyl groups? What is unusual about methyl group…
A: What amino acid side chains can be modified by methyl groups? Answer: Methylation is a process of…
Q: Which is NOT a difference between RNA and DNA? Select one: A. RNA contains uracil; DNA usually…
A: Introduction: Nucleic acids are molecules that store hereditary information for cellular growth and…
Q: On the basic structure of fungi especially on the fungal cell membrane, what do you think are the…
A: Fungus is an eukaryotic organism that include yeasts, moulds, mushrooms etc. They are composed of…
Q: In your own words how are drugs and toxins can have direct and indirect stimulation of the motor…
A: Toxins and drugs are a conceivable and prevalent significant public health problem, but they…
Q: Use the data below to determine the maximum velocity [in mM/s] of a certain enzyme-catalyzed…
A: We must know the Michaelis Menten equation: V=Vmax [S]Km+ [S]
Q: 1. The best description of how muscles move is: spinning basal bodies sliding filaments adding…
A: Muscles contract and then relax to move bodily components. Muscles can move bones, but they didn't…
Q: what are the dietary fats, and what are the dietary fat food and calorie densed beverage that lead…
A: Fats are made up of glycerol and fatty acids. Fats are classified into two types, saturated and…
Q: Which of the following is NOT a major source of protein? A. fish B. Milk C. Egg D. Rice
A: Introduction: Proteins are organic substances and polymers of amino acids. The elements present in…
Q: A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the…
A: Ribonucleic acid (RNA) is a polymer of ribonucleotides that participate in diverse biological roles…
Q: 87) For a the viral proteins a. If the viral protein is made in the RER, it will go back to the…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Problem 2. Competitive inhibitors are commonly used to make pharmaceuticals. Some cancer drugs act…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: What is the MAJOR product of the reaction catalyzed by rubisco in the Calvin cycle? Select one:
A: The Calvin Cycle is the part of the light independent reactions of photosynthesis, that widely uses…
Q: a. State TWO (2) advantages of Inductively coupled plasma-optical emission spectroscopy (ICP-OES)…
A: Advantages of Inductively coupled plasma-optical emission spectroscopy over flame atomic absorption…
Q: How does the DNA hold information?
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each…
Q: Which of the following is incorrect concerning protein structure determination by X-ray…
A: Protein structure determination by X-Ray Crystallography: is a technique used to obtain the 3D…
Q: explain why is the importance of pharmacogenetics in the world of forensic sceicn
A: Introduction: Pharmacogenetics is the study of how genetic differences in a single gene develop…
Q: Which THREE statements are true about targetting proteins to the nudieua? Aln the cytoplasm, a…
A: Nuclear localization signals mediates the transport of proteins from the cytoplasm into the nucleus.
Q: What is hydatid cyst disease? What complication/s can occur? What is cysticerosis? How is it…
A: A disease is described as a particular abnormal condition that has a very negative effect on…
Q: Draw, label, and explain the three stsges of lipid oxidation
A: Lipid peroxidation may be defined usually as a technique below which oxidants consisting of…
Q: Lane M 1 2 3 4 5 Content DNA ladder Replicate 1 Replicate 2 Replicate 3 Negative control Positive…
A: PCR stands for polymerase chain reaction. PCR is used to amplify nucleic acid segments for further…
Q: Complete the table below regarding the different laboratory tests done for Carbohydrates. Only for…
A: There are different types of tests to check the presence of carbohydrates in different chemical…
Q: n order to avoid wasting cell resources, feedback mechanisms to regulate enzyme activity are a…
A: A chain of chemical reactions where constant synthesis and degradation of the product occur in…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13A. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon sequence AGACACUCUAUUAAA has a single base pair mutation to AGACACUCUUUUAAA. If the old protein sequence was Arg-His-Ser-Ile-Lys, what will be the new sequence encoded by the mutant gene?Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…
- Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA Codons* (anticodon) tRNA Alanine GCU AGA Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG Isoleucine Leucine Lysine Methionine UUU Phenylalanine Proline CCU UCU Serine ACU UGG Threonine Tryptophan Tyrosine Valine UAU GUA There are 64 codons. Some amino acids have several mRNA codor There is, however, no overlap of codes.Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
- BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation LeadpleMRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
- Compare the two DNA sequences shown below and consider the single nucleotide mutation made in the lower DNA sequence (shown in bold font). This is an example of a mutation. DNA: ATG CGC ТСС САТ стт ААС АAА GAG GTT GG C TAT TT Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe DNA: АTG CGC ТСС САТ стТ ААС АAG GAG GTT GGC ТАТ ТТT Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe missense nonsense frame-shift silent antisense5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this geneSequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.