A 13-nucleotide section of an autoradiogram from a Sanger sequencing experiment is depicted in the image below. Based on the band pattern observed here, write out the sequence of both the complementary strand generated during the experiment, and the template strand that is being analyzed. Be sure to clearly indicate the 5' and 3' ends of each. ddATP ddGTP ddCTP 1 ddTTP 3' 5' Tyne a short answer in the space provided below
Q: Glycogen synthesis and glycogen breakdown are catalyzed by separate enzymes. Contrast the reactions…
A: Glycogen is a carbohydrate, which is a polymer of glucose. Glycogen is also stored in human body as…
Q: Elytra Pterostigma Raptorial Fossorial Exopterygote Endopterygote Vas deferens Spermatheca…
A: Invertebrates belonging to the class Insecta are pancrustacean hexapods, or insects. They make up…
Q: ted at the S phase of the cell cycl le to synthesise DNA. to divide even when they are tig unction…
A:
Q: Hylobates is chosen as the outgroup. Why? a. The genus Hylobates morphologically resembles the…
A: Hylobatds are catarrhine primates. their nostrils are close together and face forward and slightly…
Q: (6) Which of the following descriptions regarding human genetic variations is correct? A) Unlike…
A: SNPs may effect promoter activity or gene expression, messenger RNA ,conformation stability, and…
Q: The major structural difference between soluble globular proteins and membrane proteins is: a.…
A: The shape of globular proteins is spherical. These are among the protein subtypes that are most…
Q: How has the mutation altered the polypeptide? Is the function of the hemoglobin molecule (which…
A: Sickle cell disease is a blood disorder characterized by sickle shaped RBCs which has got less…
Q: Manic-depressive illness Diabetes mellitus Sickle-cell anemia T-cell leukemia Liver-cell cancer…
A: The reason is that the band labels are the names of diseases and all the diseases listed in the…
Q: Protein Questions 1. The monomers of proteins are called Amino acids 2. The portion of each amino…
A: Proteins are the final product of a gene that are produced from the genetic code on present in the…
Q: Which type of connective tissue typically stores fat? A Blood B Fibrous connective tissue C) Adipose…
A: The tissue is a group of cells that carry out a specific function. The connective tissue connects…
Q: Rooneyia is an Eocene primate fossil. This ____ found in Texas is distinct from other North American…
A: Introduction Fossils are the remains, footprints, impressions, or evidence of extinct species. These…
Q: Which of the following is NOT a valid evolutionary explanation for why aging (or senescence)…
A: An organism begins to weaken and frailty as it ages, which is a natural occurrence. Once a person…
Q: If member 3 was married by an affected person, draw the punett sqaure and comment on the results by…
A: The pedigree represents an autosomal recessive inheritance because the trait is present in first…
Q: If one mole of glucose goes through glycolysis and TCA cycles, how many moles of NADH are produced?…
A: Glucose is a 6-carbon sugar that is used to generate energy in the form of ATP through a process…
Q: Based on the results, do you think the patient is consistent with what you would expect from a…
A: The Colony Morphology of the bacteria suggests: 1. Streptococcus pneumoniae: Greenish irregularly…
Q: True or False 1. In a generic cell, the concentration of Cl- is lower outside than inside 2. A…
A: A cell membrane is a protective barrier present around a cell. It is also known as the…
Q: Which type(s) of chromosomal aberrations result from chromosomal breaks on different chromosomes?…
A: <!--<SUB-PART>--> (a) <!--<SUMMARY-INTRODUCTION>--> To Determine: If the…
Q: What enzyme is the rate limiting step in steroid hormone synthesis?
A: Enzymes are proteins that increase the rate of a chemical reaction by many folds. They are for…
Q: What is one problem with using only anatomical features to determine how closely related organisms
A: Species is a group of interbreeding individuals which have similarities not only in their anatomy…
Q: is this true ot false the products of respiration are the reactants of photosynthesis.
A: Respiration is a catabolic, biochemical process, that involves the stepwise, complete or incomplete…
Q: (a) (c) Number fledged Mean calves per year Mean eggs per day 2 (378) (184) (73) (26) (39) *** 2.0-…
A: A graph is a visual representation of the data gathered. A survivorship curve shows the number or…
Q: Describe the mechanism involved in the development of Grave’s disease?
A: Hyperthyroidism is always associated with hypersecretion of thyroid hormones along with numerous…
Q: of the following is the most likely impac ship between Species A and B? ivores Absent Insect Herbiw…
A:
Q: (4) What is the difference in the genome size (approximate number of base pairs) between a normal…
A: Introduction A genome is a representation of all the genetic material that makes up an organism and…
Q: 5- ddNTP differs from dNTP in..... and N is representing... a) The first has no OH in both C 1,2,…
A: Introduction The fundamental units that make up nucleic acids are called nucleotides. It is made up…
Q: What type of nonparametric test should be used to evaluate the effectiveness of an exercise program…
A: The pressure extered by blood against the walls of the arteries is called blood pressure. The normal…
Q: (a) Write the reaction in words catalyzed by the enzyme for the alternative substrate, describe how…
A: The enzyme phosphofructokinase-1 catalyzes an important reaction in glycolysis. The reaction…
Q: Discuss the pathophysiology of Fragile-X. Include the etymology of the name Fragile-X & why symptoms…
A: As the name suggest fragile X syndrome is an inherited disease, the mutation occurring inside one of…
Q: What sorts of biological changes would have been selected for that may have contributed to…
A: Encephalization An evolutionary rise in the complexity or relative size of the brain, involving a…
Q: (A) Prokaryotic gene expression is a complex process that is controlled at many levels…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Characteristics of Living Things Directions: identify which characteristic of living things is being…
A: Introduction : Millions of plants and animals that have been identified and characterised make up…
Q: Vinblastine is a standard chemotherapeutic drug used to treat cancer. Because it interferes with the…
A: There are a few important points : Abnormal proliferation of cells without differentiation and…
Q: You studied the intermembral index in Lab 4. The graph below plots new data not in this lab for…
A: ANSWER: The correct option: 109 ; vertical clinging and leaping intermembral index of 109
Q: Which of the following is a stage in the light independent reactions in photosynthesis (Calvin…
A: Calvin cycle Calvin cycle is also known as dark reaction or light - independent reaction, because it…
Q: Which of the following statements concerning the complete oxidation of FADH2 in the electron…
A: Introduction :- An electron transport chain is a collection of protein complexes and other molecules…
Q: What are the differences between humoral and cellular immunitie?. Also, identify and explain the…
A: Immune system is a complex network of biological processes that defend an organism against…
Q: to search chromosomes amino acids 10 mRNA 11 ribosomes 12 13 14 15 16 17 18 19 These strands are…
A: The answer is mRNA
Q: a) Create its complementary strand. b) Show 3 different types of mutation that can happen to this…
A: Humans and nearly all other species contain their genetic information in DNA, also known as…
Q: Air moves through a series of cavities, tubes, and openings Also known as inhalation Also known as…
A: The relationship between gas pressure and volume aids in the understanding of breathing mechanics.…
Q: How many NADU molecules are produced on each turn of the citric acid cycle? a. one b. two c.…
A: Introduction: Cellular respiration includes the Krebs cycle, the TCA cycle, and the citric acid…
Q: organisms survive without sunlight and photosynthesis
A: Generally, the most of the organisms survive through a process known as Photosynthesis.…
Q: How does this term epidemiological studies apply to current pandemic statistics: Covid -19 testing…
A: The study of epidemiology is crucial in the battle against any disease. In the fight to comprehend,…
Q: The extensive distribution of insects is as a result of: i) Their ability to fly, ii) Their small…
A: Introduction On earth, insects predominate over other living forms. A single acre of land may…
Q: Which of the following statements about our defenses to protect DNA are correct (select all that…
A: Each organism's DNA sequence is unique. Its base-pair sequence might vary from time to time. It is…
Q: 22. A 10-year-old boy suddenly encounters a large, ferocious dog while riding his bicycle. His heart…
A: Introduction :- A hormone produced by endocrine system glands is referred to as a neurological…
Q: and they/ it start(s) from the mRNA 4-Some/ one application(s) for DNA are/ is Therefore, the…
A: Single-stranded RNAs of the type known as messenger RNA, or mRNA, are used to make proteins. mRNA is…
Q: tropic
A:
Q: Q4.15. When two salamander species, the red-backed salamander and the valley-and-ridge salamander,…
A: Introduction: We can predict the jaw structures based on a variety of parameters, including the…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- The short DNA shown below is to be sequenced. Using your knowledge of how the Sanger method works, in the gel diagram, draw in the bands that will appear when DNA polymerase is added to the reaction along with the four different nucleotide mixtures indicated. Note that some of these mixtures are not what would normally be used in a sequencing reaction. Dideoxynucleatides (ddNTPs) are added in relatively small amounts. The asterisk represents a radioactive label. *5' - 3'-ОН 3' – -- ACGACGCAGGACATTAGAC-5' Nucleotide mixtures: A. DATP, DTTP, dCTP, DGTP, ddTTP (given) B. DATP, ATTP, dCTP, AGTP, ddATE C. dTTP, dGTP. ACTP, ddCTP, ddATP D. DATP, dCTP, dTTP, ddGTP A в с D | || ||For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’Given the DNA sequence of the restriction enzyme: gi|6329444|dbj|AB034757.1| Hynobius retardatus mRNA for larval beta-globin, complete cds GCAGAATCTGACTCAAGAAATCCCTCCTCACCCAACACCACCAGCAGCCATGGTTCACTGGACAGCAGAGGAGAAGGCAGCCATCAGCTCTGTGTGGAAGCAGGTGAACGTGGAGAGCGATGGACAGGAGGCCCTGGCCAGGTTGCTGATCGTCTACCCCTGGACCCAGAGATACTTCAGCTCTTTTGGGGACCTGTCGAGCCCAGCTGCCATTTGTGCCAACGCCAAGGTCCGTGCCCATGGCAAGAAGGTCCTGTCCGCCCTGGGAGCCGGCGCCAACCACCTGGATGACATCAAAGGCAACTTTGCTGATCTGAGCAAGCTTCACGCAGACACACTCCATGTGGACCCCAATAACTTCCTGCTCCTGGCAAACTGCCTGGTGATCGTCTTGGCCCGCAAGCTGGGAGCCGCCTTCAACCCTCAAGTCCATGCGGCCTGGGAGAAGTTCCTGGCCGTCTCCACCGCGGCTCTGTCCAGAAACTACCACTAGAGACTGGTCTTTGGGTTTAATTCTGTGAACGTCCCTGAGACAAATGATCTTTCAATGTGTAAACCTGTCATTACATCAATAAAGAGACATCTAACAAAAAAAAAAAAAAAAAAAAAAAAAA Identify two blunt-end cutters Identify two sticky-end cutters. For each, Provide the sequence of the Restriction enzyme, Highlight using a specific color where the DNA sequence where the restriction enzyme will cut the DNA Indicate the…
- 5'-[seq]-3' The diagram shows the results of gel electrophoresis for Sanger sequencing. The wells are represented by open boxes and the DNA bands are represented by black boxes. The wells are labeled to show which dideoxy reaction was loaded into each. Write the sequence of the original template strand used for this sequencing reaction, with the 5’ end on the left and the 3’ end on the right.The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given aboveIn a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand
- A student is running gels to sequence a DNA fragment as below. In addition to running four sequencing reactions with the requisite ddNTPs, they also include four ‘mystery’ reactions representing variants of the first sequencing lane (using ddATP to sequence T in the template) in which one or more components of the reaction have been omitted or inappropriately added. Give a possible explanation for the what was inappropriately added/omitted in each mystery lane. Note two important things: firstly, even if everything works perfectly there is still always some unextended primer in a reaction. Secondly, there may be more than one possible explanation for some lanes; just give one.Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TGCTATC 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. This primer cannot be used in the PCR process. b. It will bind to the top strand on the left side of the fragment. c. It will bind to the bottom strand on the left side of the fragment. d. It will bind to the bottom strand on the right side of the fragment. e. It will bind to the top strand on the right side of the fragment.The chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?
- Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The highlighted sequences indicate the region bound by primers, either on this strand or on the other complementary strand. 5' ACGTGCGACACGTATATATGTCGCGTGAGTGTAGCGTATCGCTAGAGACGCATACCTATG 3' If the sequence of the forward primer is 5' GCGACACG 3', which of the following sequences would represent the reverse primer? a. 5’ – CAGAGATCGC – 3’ b. None of these sequences would represent the reverse primer c. 5’ – GTCTCTAGCG – 3’ d. 5’ – GCGATCTCTG – 3’ e. 5’ – CGCTAGAGAC – 3’In the Sanger (dideoxy) method for DNA sequencing, a small amount of a dideoxynucleoside triphosphate—say, ddCTP—is added to the sequencing reaction along with a larger amount of the corresponding dCTP. What resultwould be observed if the dCTP were omitted?You were going to sequence a rice DNA fragment whose sequence was only know at one end, as shown below. 5’ AAACGATCGAGTCGCATCCAAAATCGATACCC—unknown region 3’ TTTGCTAGCTCTGCGTAGGTTTTAGCTATGGG—unknown region After several tries, you obtained a beautiful sequencing image as shown here: The worked out well partially because you had designed a primer for sequencing the unknown region according to the following guideline: Tm is 55 – 60°C. Ensures primer had a appropriate melting temperature for PCR ans sequencing. The GC content of the primer is the same as the genome/template (rice = 60%, human/Drosophila = 45-50%). A same nucleotide cannot be more than 2 in a row, e.g. CCC, GGGGG, AAA. The secondary structure of the primer must be none or weak. No primer dimers (The primer anneals to itself). 3’ end is the most important: it should not end in A, preferably ends in GG, GC, CG or CC This website can help you design the primer: http://www.oligoevaluator.com/OligoCalcServlet…