3. Using the below hypothetical character matrix of traits (left column) for these imaginary taxa (top row), choose the most likely phylogeny (a, b, or c), assuming that the Priltezon is the outgroup. Here presence is indicated by yes(Yes), and absence is no (No). Priltezon Frizzle Millispeed Bragoon Tortlouse Catellini Fur no no no No No Yes Eyes no no no no Yes Yes Six arms no no no yes Yes Yes Ears no no yes yes Yes Yes Backbone no yes yes yes Yes Yes b. C. a. P F T M B M B F T P C PMBFCT
Q: Consider this scenario following several generations of frogs and then answer the following…
A: In the context of evolution, the key indicator of evolution occurring is a change in the allele…
Q: An athlete tested positive for Methylhexaneamine in urine with a level of 0.90 µg/mL. At her appeal…
A: In competitive sports, the accuracy and reliability of doping tests are fundamental due to their…
Q: -Centromere D D Ø ☹ A B ℗ ℗ D E C
A: The objective of the question is to understand the chromosomal condition during the prometaphase…
Q: (a) 5' 3' GGCGCAGUGGGCUAGCGCCA (b) (((((..AAAAAA. ))))) (၁) AAAGGCCCAU aaaaaa.
A: The H-type pseudoknot is a common RNA structure composed of two helical stems (S1 and S2) and two…
Q: What are our conscious and inadvertent effects on evolution and biodiversity?
A: Intentioned and inadvertently changing biodiversity and evolutionary shapes, human action contains a…
Q: A bacterial culture is initially composed of 100 cells. After 1 hour the number of bacteria is 1.5…
A: The given answer calculates how long it will take for bacterial populations to quadruple in perfect…
Q: developing my and rende hope to prevent C 20- 10 30- Show the quantities of selected vitamins and…
A: The questions below the diagrams are as follows:(i) Explain how the undamaged villi are adapted for…
Q: Which of the following would tend to DECREASE uptake of water by a plant root hair? Increasing the…
A: The question is asking which of the given options would decrease the uptake of water by a plant root…
Q: The most common type of leukemia is: Question 8 options: A) CML.…
A: The question is asking us to identify the most common type of leukemia. Leukemia is a type of cancer…
Q: Which layer(s) of the GI tract is/are made up predominately of connective tissue?
A: Cells are the smallest and most basic functional structure of biological entities. When a group of…
Q: According to Johannes Kepler’s third law, the above planet must be: closer to the sun than the Earth…
A: Kepler's Third Law: the squares of the orbital periods of the planets are directly proportional to…
Q: In the 1960 's the advertisement for a lecture by a whimsical biologist began as follows: "Available…
A: Certainly! Let's break down the advertisement piece by piece:1. "Available now. Linear Motor. Rugged…
Q: Tale Which of the following are determinants of arterial oxygenation? Select all that apply. A) CO2…
A: A) CO2 levels in the blood: The amount of carbon dioxide (CO2) in the blood can affect arterial…
Q: A map of a pond ecosystem
A: An individual or organism carries out all the life processes and is considered a distinct entity. It…
Q: Which of the three phylogenetic trees of the Drosophila species is different from the other two? a.…
A: Approach to solving the question:Carefully observe the 3 trees and find which is different Detailed…
Q: Why do positive feedback systems that are part of a normal physiological response include some…
A: Positive feedback loops are fundamental to physiological processes. This framework is fundamental in…
Q: This form of a food web begins with waste materials and the remains of dead organisms. a. aquatic d.…
A: In ecology, a food web describes the complex network of interactions among various organisms linked…
Q: How is the brain involved in the regulation of body temperature?
A: Maintaining homeostasis within the human body requires the imperative physiological work of…
Q: here in an angiosperm would you find a megasporangium? (A) in the style of a flower (B) enclosed in…
A: The megasporangium, or nucellus, is found interior the ovule in angiosperms. The ovary, a portion of…
Q: A woman exercises at a relatively low-intensity on a treadmill for 1 hour. Her VO¬2 is 1.6 L/min and…
A: When exercising, the body essentially uses carbohydrates and fats as energy sources, the proportions…
Q: In his heliocentric model of the solar system, Nicolaus Copernicus would identify the above planet…
A: Detailed explanation: In Nicolaus Copernicus' heliocentric model, the planet depicted above would be…
Q: . In prokaryotes and eukaryotes, describe what else is happening to the RNA while RNA polymerase is…
A: RNA synthesis, which is carried out by RNA polymerase, maybe a basic movement in both prokaryotes…
Q: Genetics Q1
A: The objective of the question is to calculate the number of DNA sequence copies after 29 rounds of…
Q: Question 1 0.5 pts Which of the following is not one of the 4 main fields of Anthropology? Cultural…
A: 1. Answer:- Modern AnthropologyExplanation:Anthropology is broadly divided into four main…
Q: State and explain 3 factors that affect enzymatic activities
A: Here are 3 factors that affect enzymatic activities and how they influence enzyme function:Substrate…
Q: Genetics Q6
A: The objective of the question is to identify the factor that determines how far DNA will travel from…
Q: 20) Biological control of Salmonella is by using: a) E. Coli (ETEC Strain) b) Shigella c)…
A: 20. Control of Salmonella using Bdellovibrio: Bdellovibrio is a unique predatory bacterium that…
Q: Pregunta 1 (1 punto) ¿Donde se encuentra el banco persistente de semillas? a En el suelo enterradas…
A: 1A) Translation of Spanish Text to EnglishOriginal Spanish Text:La respuesta correcta es a) En el…
Q: Child Obesity (youtube.com) 1.) After watching the video, provide impressions regarding the impact…
A: Approach to solving the question:To effectively address the impact of childhood obesity on the…
Q: which of the following do researchers not need to use during vector cloning? a. a plasmid containing…
A: Certainly! Let's delve deeper into each option:a. Plasmid containing selectable marker genes: When…
Q: When researchers first discovered that airflow through a bird’s paleopulmonal parabronchi is…
A: The respiratory framework of birds highlights a one of a kind instrument for gas exchange, distinct…
Q: RELPs: A. are the same length for mutant and normal beta-globin alleles. b. determine the sequence…
A: Approach to solving the question: Read through each statement carefully and determine which ones…
Q: E2F is a transcriptiion factor that activates genes for DNA rep- proteins. In addition with RBR,…
A: The capacity of a single cell to isolate and create into a whole organism is known as totipotency.…
Q: Water absorption by roots is under the influence of
A: Transpiration is a process through which the loss of water takes place from the exposed parts of the…
Q: Choose all true statements about the difference between translation at free ribosomes versus bound…
A: The question is asking us to identify the correct statements about the differences between free…
Q: GQ16
A: The objective of the question is to identify the correct statement about the biological process of…
Q: How would most biologists and anthropologists explain the reasons behind why primates do specific…
A: Primate behavior is generally understood by scientists and anthropologists to be the consequence of…
Q: Describe at least 3 traits that are different between Old World Monkeys and Apes. Is Curious George…
A: The objective of the question is to identify the differences between Old World Monkeys and Apes, and…
Q: What prevents overinflation of the lungs? partial pressure of oxygen in alveoli…
A: The question is asking about the mechanism that prevents the lungs from overinflating, which could…
Q: Part 2 - Multisystem anatomy - Label the structures indicated in the sagittal abdominopelvic region…
A: provided sagittal section image ofthe abdominopelvic region showcases major anatomical structures…
Q: Which of the following molecules is an inducer of the lac operon: a. Galactose d. Isothiocyanate b.…
A: The lac operon may be a well-studied model of gene control in microscopic organisms, notably E.…
Q: Define about genome-wide association studies (GWAS) ?
A: Genome- Wide Association Study (GWAS) or Whole genome association study (WGAS) is a study of…
Q: What does “descent with modification” mean? a. Populations that change quickly are likely to become…
A: "Descent with modification" is a core concept in evolutionary biology that Charles Darwin…
Q: Calculate the amount of protein (in mg) in Sample 1 if the measurement at A280 = 0.636, taking into…
A: The amount of protein in a sample can be found by using a special machine that measures how much…
Q: What type of mating system developed in Round 1 without male parental involvement? Why? What type of…
A: A) Round 1: Without male parental involvement, the mating system that developed was a promiscuous…
Q: -Centromere D D Ø ☹ A B ℗ ℗ D E C
A: The objective of the question is to understand the chromosomal condition during the prometaphase…
Q: Part 3 - Label the structures indicated in the transverse abdominal section shown. 2. 3. 1. 4. 5. 6.…
A: Here's a brief overview of each of the anatomical structuresVertebra:Vertebrae are the individual…
Q: 1) Enter a number without the word "tree". ________ 2) Determine the proper numerical value for…
A: To determine the phylogenetic tree using the UPGMA procedure, we need to follow these steps: Step 1:…
Q: What kind of dentition do strepsirhines have? What kind of food do they eat and how do their teeth…
A: Approach to solving the question:1. Define strepsirhines and their dentition.2. Discuss their…
Q: Look at the conditions on the terms and descriptions or definitions on the right. Match each…
A: Here are the matches:species richness: measurement of the number of species presentlow resistance: a…
Step by step
Solved in 2 steps
- 10. Refer to the figure shown. Species Stripe Color 1 2 3 B. C R The figure shows the phylogeny of seven species of beetles (A-G) and whether the beetles have (?) or do not have (x×) one of three stripes. It also indicates the color of the beetle (R for red and G for green). Based on the phylogenetic tree and the principle of parsimony, the absence of stripe in species is most likely O 1; E and F; an evolutionary reversal O 2; E and F; due to convergent evolution O 2; E and F; a synapomorphy O 1; E and F; a synapomorphy O 1; E andF; due to convergent evolutionBased on the information from the following table and the provided phylogenetic tree, what kind of species classification is shown? A B C D E F G H 1 J K L M N O Form of Male Genitalia 1 1 L L L L L L L L L L L L L r T Pits) or Tubercles E P P T T T T T P P P P P Р P P O Phenetic Species Concept O Blological Species Concept O Phylogenetic Species Concept O Sympatric Species Concept Blayple (OUTGROUP) beaver Dan, AZ -Twentynine Paime, CA -Harkavilla, UT D-Chilchinbio, NM -Vermilion Cas. AZ 64 -F-Mone Lake, CA -G-Coral Pink Danes, UT H-Pyramid Lake, N -Crescent Dunes, MV Meno Lake CA -K-Olancha CA -Olancha, CA --Winnemucca, NV -El Mirage, CA Lo-Dumont Dunes, CA Form of dorsal ridges M₁ M₁ FFFFFFFFFF M Ma M₂ M₂Below are phylogenetic trees depicting the relationships among four species, A, B, C, and D. Which of the following statements is correct? ABCD ADCB DCBA D CAB (1) (2) (3) (4) Tree (1) and Tree (2) are the same tree. Tree (2) and Tree (4) are the same tree. Tree (2) and Tree (3) are the same tree. All four trees are in fact the same tree. All four trees are in fact different trees.
- 23 . When constructing a cladogram, which of the following is considered most useful for determining evolutionary relationships? Group of answer choices shared derived characters vestigial structures homoplastic characters morphological similarities shared ancestral characters2. A В CDE FG H (a) In the phylogeny above, which of the following groups are monophyletic? (1) A, B, C, and 1 (ii) A, B, C, 1, and 2 (iii) D, G, H, 3, 4, 5, and 6 (iv) E, F, and 3 (v) A, B, C, and 7 (b) For each group above that you did not select, please indicate whether the group is paraphyletic or polyphyletic. (c) Which numbered node corresponds to the most recent common ancestor of B and H?The table shows the distribution of traits (A-E) in six extant species (1-6). A “0” indicates the ancestral condition, and a “1” indicates the derived condition. 1. Which trait is least informative of phylogenetic relationships within the group? 2. Which species has the fewest number of derived characters?
- Activity 4. The Cladogram Direction: With the cladogram below as a basis, answer the following questions in the space provided. Skin shields Two Horn moil bogsvih ya Horn owi tarl A hypothetieal cladogram with taxa designated as the letters O, A, B, C, and D. Retrieved from Kardong (2012) Fig. 1. Which is the outgroup here? O, A, B, C, or D? 2. Which is the sister of the group of D? 3. Grouping A, B, and D together (excluding C) creates which kind of grouping? 4. Which taxa share the characteristic of "skin shields"? 5. What characteristic is homologous among A, B, C, and D? 30 6. Write down the taxa that would make a paraphyletic grouping. 7. Write down the taxa that would make a monophyletic grouping. 8. Which characteristic is absent in O but is a homologous characteristic among A, B, C, and D? 9. Which is a unique characteristic present in A, B, and C which is absent in D? 10. Will grouping O, A, B, C, and D create a valid clade?3. Which of the following phylogenies is different from the other three? B DECGA F a F F d B' FAG CEDB One additional concept that will likely be unfamiliar to many of you is that of crown vs. stem groups. As their names imply, crown groups are clustered toward the tips of a phylogeny, while stem groups are clustered toward the bottom of a phylogeny. This is a general pattern and not a fixed and precise rule, however, as both extinct and extant groups can be part of the "crown" group. The deciding factor that determines the delineations of a crown vs. stem group is whether the synapomorphies that define the group under examination are present. For example, you could have a whole cluster of mammals, some of which are extinct, but all of which show all of the characteristics currently used to define mammals. In this case, any extinct groups that show all mammalian features would be classed as crown mammals. In contrast, any extinct groups that branch off on the way to mammals, but did…2. Using the labels (numbers and letters), identify the following concepts of relatedness in the cladogram shown below: plesiomorphy, symplesiomorphy, synapomorphy. - B D Plesiomorphy: Symplesiomorphy: Synapomorphy:
- A phylogeny of 5 species of birds is shown below with values for three different phenotypic traits for each species shown in the rows above (e.g., species A has a wide, long beak and red tail, while species C has a narrow, very long beak and a green tail). DNA sequencing of tissue samples found buried in a freezer confirms that an extremely rare and reclusive species (D) is a sister species of E, but preserved samples of entire individuals of species D have been lost, the original collector of the samples has passed away, and no individuals of species D have subsequently been seen in the wild. In other words, we have no idea what species D looks like. Employing the principle of parsimony, which of the following conclusions is MOST appropriate for the likely values of these traits in species D? Beak width: wide wide ?? narrow narrow Beak length: long long ?? long very long Tail colour: red blue ?? green green A E a) wide beak, very long beak, green tail b) narrow beak, long beak, all…The phylogenetic tree to the right showsthe evolutionary relationships of taxa A –H. The shapes represent character statetrait changes. A. Which traits (shapes) would individualsin taxa D have? Draw the collection oftraits. B. Is the triangle a synapomorphy orpleisomorphy (circle one)? C. Is the circle a synapomorphy orsympleisomorphy (circle one)?What is the purpose of using an outgroup when reconstructing a phylogenetic tree? [at least mention 4 points]