2. The following DNA sequence was isolated from an interesting thermophilic bacterium. The Shine Dalgarno sequence used by this bacterium is AGGAGGU and is located approximately 5 nucleotides away (upstream) of the start codon of the ORF. 5' GGTCGTGCTGGGTTGAGAAATGCCTACGTGCTGCTAGTTGGGAGCTCCATAGGGGACCTCCTGGGT 3 A) What is the sequence of the ORF encoded on the resulting mRNA (include only the region from start to stop codon). Include 5' and 3' ends. What is the amino acid sequence of the protein generated from this ORF? (Include amino (N) and carboxy (C) termini express using three letter codes). If the bolded and underlined "G" is mutated into an "A", what effect would you expect this to have on the resu function of the protein? Explain briefly. CD
2. The following DNA sequence was isolated from an interesting thermophilic bacterium. The Shine Dalgarno sequence used by this bacterium is AGGAGGU and is located approximately 5 nucleotides away (upstream) of the start codon of the ORF. 5' GGTCGTGCTGGGTTGAGAAATGCCTACGTGCTGCTAGTTGGGAGCTCCATAGGGGACCTCCTGGGT 3 A) What is the sequence of the ORF encoded on the resulting mRNA (include only the region from start to stop codon). Include 5' and 3' ends. What is the amino acid sequence of the protein generated from this ORF? (Include amino (N) and carboxy (C) termini express using three letter codes). If the bolded and underlined "G" is mutated into an "A", what effect would you expect this to have on the resu function of the protein? Explain briefly. CD
Anatomy & Physiology
1st Edition
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Chapter3: The Cellular Level Of Organization
Section: Chapter Questions
Problem 17RQ: Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG...
Related questions
Question
Urgently needed
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by step
Solved in 2 steps
Recommended textbooks for you
Anatomy & Physiology
Biology
ISBN:
9781938168130
Author:
Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:
OpenStax College
Anatomy & Physiology
Biology
ISBN:
9781938168130
Author:
Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:
OpenStax College