1.Systemic arteries/arterioles 2.Systemic capillaries 3. systemic veins/venules 4. Lungs (or going between heart and lungs) 5. heart 90%, 7%, 13%, 30%, 20%, 64%, 9%
Q: Which of the following levels of organization is arranged in the correct sequence from most to least…
A: Ecosystem: An ecosystem is a broader concept that encompasses both living (biotic) and non-living…
Q: two mutational events are sufficient to cause some forms of cancer, what distinguishes familial…
A: Generally, individuals inherit one mutation that can increase the chances of cancer. This mutation…
Q: See image
A: AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT
Q: Maximum Activity No Activity Pepsin Sucrase Trypsin 11 12 PH This graph shows the activity level for…
A: The frequency of enzyme-substrate interactions or the ability of the enzyme and substrate to…
Q: In the three different energy systems, name the energy compounds, and which systems are stressed…
A: In exercise physiology, there are three primary energy systems that the body utilizes to produce ATP…
Q: What is the Average, Standard Deviation (SD), Coefficient of Variation (CV) and % cell density group…
A: Calculate the Mean:Mean (μ) = (Sum of all values) / (Number of values)μ = (100,000 + 50,000 + 25,000…
Q: external lactose cell membrane on RNA polymerase promoter lactose permease B-galactosidase…
A: Genes that are connected to one another, such as those participating in the same metabolic process,…
Q: 6 = W - 1 A 2 C ♦ ( ◆ ♦ N/A (> ◆ ◆
A: In a complementation chart a group will contain similar mutations that failed to compliment one…
Q: Which of the following is NOT true about metabolic pathways in general? They can be anabolic or…
A: In the complex world of cellular metabolism, various biochemical pathways play crucial roles in…
Q: Answer the following (explain in 1-3 sentences) Description: Embryonic Origin: Function: Location in…
A: Tissue is a group of similar cells that usually have a common embryonic origin and function together…
Q: 88 8 6 8 8 8 8 8 8 8 8 8 8 10 11 12 JOS COC 88 88 88 13 15 16 83 88 30 48 88 19 20 21 22 80 XY…
A: It is a medical condition caused by mutation or abnormalities in the gene of an organism. These can…
Q: What is the best desccription for these tissues: Cartilage, Vascular (Blood) Tissues, Reticular…
A: Tissue can be described as a group of similar cells that usually have a common embryonic origin and…
Q: Complete the sentences. Each term may be used more than once. In a circular bacterial chromosome,…
A: The structure and behavior of DNA play a crucial role in the functioning of living organisms. In…
Q: What does the phylogeny suggest about the likely mechanism of speciation between H. matsudairae and…
A: If two populations can interbreed with each other then they belong to the same species. The…
Q: Male and female pronuclei form Secondary oocyte present in oviduct Oocyte activation Meiosis…
A: A crucial biological process known as fertilization occurs when an egg cell containing genetic…
Q: Which are functions of the male reproductive system? Select all that apply. Check all that apply. To…
A: The male reproductive system comprises the testes, which produce sperm and hormones such as…
Q: two chromosomes with the same alleles in the same sequence two chromosomes with identical alleles…
A: According to the guidelines of Bartleby,“Since you have posted multiple questions, we will provide…
Q: DNA Replication and Protein Synthesis Review mmg Template strand SSB B- DNA polymerase Replication…
A: DNA replication is the cellular procedure for making an exact copy of its DNA. It's like making a…
Q: Question 14 The scientist (scientists) who used enzyme-digesting proteins to show that protein was…
A: Dear student,As per the Bartleby policy, I am answering the first question only. To answer the…
Q: 6. Which amino acid would MOST likely be found in the interior of a globular protein? a. Ala b. Asp…
A: Amino acids are the building blocks of proteins . There are 20 naturally occurring amino acids. Out…
Q: platypus is one of a very small number of mammals that are venomous. Researchers compared the…
A: Most important part in this paragraph is that the two proteins are almost similar in function and…
Q: The highest level of transcription of the E. coli lac operon occurs when CAP (+cAMP) is bound to the…
A: The lac operon in E. coli is a system of genes that regulates the metabolism of lactose, a sugar.…
Q: https://www.youtube.com/watch?v=FVuNTiqHys0 Do you think that animals like Koko who has the…
A: The hypothesis proposes that all species of life forms emerge and create through the natural…
Q: In ZZ-ZW sex determining systems which of the following is true? O Insects such as bees, wasps, and…
A: Sexually reproducing organisms show two types of sexual characteristics. They are responsible for…
Q: what would the Pharmacokinetics and Pharmacodynamics be of an hullicinate drug like LSD that acts as…
A: LSD (lysergic acid diethylamide) is a well-known psychedelic that acts as a partial agonist at the…
Q: The Swedish Botanist Carolus Liññáéus is recognized as the firs regarding the work of Linnaeus is…
A: Option 1: Linnaeus' work followed other Naturalists but his work was deemed unifying and so he…
Q: cross between two heterozygotes fruit flies with purple eyes and white bodies (EeBb) results in 4…
A: Parent 1: EeBbParent 2: EeBbEye color : EeHomozygous dominant (EE): Purple eyesHeterozygous (Ee):…
Q: Select the statements that are reasonable interpretations of this figure regarding the hatching…
A: Hatching success does not appear to be affected by precipitation. This statement is not a…
Q: A common soil fungal species is suddenly detected as an aggressive wheat pathogen, decimating crops…
A: Fungi are a group of microorganisms that belong to the kingdom Fungi. They are eukaryotic organisms,…
Q: Match each function to its site of action in the nephron. Glomerulus- Proximal- convoluted tubule…
A: Kidneys are bean-shaped organs present in pairs in humans located in the abdomen. The function of…
Q: the experiment was repeated many times to improve the precision of the measurements O global…
A: dctA enhancer element :bacteria,the dctA enhancer element is a DNA sequence that regulates the…
Q: In assessing data that fell into two phenotypic classes, a geneticist observed values of 20:150. She…
A: Two phenotypic classes Phenotype 1 and Phenotype 2 observed values 20:150 and two different null…
Q: What are the indications and contraindications of a bone marrow aspriate and a bone marrow biopsy.
A: Bone marrow is the soft and spongy tissue found within the cavities of certain bones, primarily the…
Q: pea plants yellow seed color, (GG) and round seed shape (WW) seeds are dominant traits, wh green…
A: The allele G (dominant) is responsible for yellow phenotype and the allele g (recessive) is…
Q: Differentiate anaerobes from aerobes and describe how they are cultured. Explain how both aerobes…
A: Biofilms are structured communities of microorganisms that adhere to surfaces and are encased in a…
Q: There are several main model systems through which the first set of major breakthroughs in the…
A: The initial advances in our comprehension of cell cycle regulation are the topic of the question.…
Q: *The normal color of snapdragons is red. Some pure lines showing variation in flower color hav been…
A: The inheritance of flower colors in snapdragons is a classic genetic study that provides insights…
Q: cientists have seen the rate of growth of phytoplankton biomass across the Arctic Ocean increase by…
A: Phytoplanktons are the autotrophic components of freshwater or ocean ecosystemsIn the Arctic Ocean,…
Q: Question 68 Sister chromatids are best described as two chromosomes having the same genes in the…
A: According to the guidelines of Bartleby,"Since you have posted multiple questions, we will provide…
Q: Cataracts develops
A: Cataracts:These are the eye conditions which are common where the natural lens of the eye becomes…
Q: Analyze the following pedigree and determine the mode of inheritance. Assume that the traits being…
A: The correct answer is option D. Sex-linked recessive.
Q: Find a image of life cycle of Zygomycota and Ascomycota: The image of Life Cycle must have: •…
A: Fungi are eukaryotic microorganisms. This can be divided into following classes - Ascomycota and…
Q: Based on these graphs, and assuming head raises of European finches helps watch for predators but…
A: The first graph (a) depicts the relationship between the total head raises of the flock per minute…
Q: QUESTION 28 Iodine is needed for proper thyroid function. 20 mg is a typical amount of iodine in a…
A: The interconnected disc like structure which is present in internal membrane of chloroplast is known…
Q: What is one anatomical trait that is present in both Adapoids and Omomyoids? A. A bony ear tube…
A: Adapoids are relatives of current day lemurs, lorises and bushbabies. They lived during the Eocene…
Q: Zika virus is chiefly spread using an insect vector, more specifically, mosquitoes. Given this,…
A: Here, the correct answer is option d.) Climate change extends the habitat of mosquitoes that can…
Q: QUESTION 5 Which of the following is (are) problematic when the goal is to construct phylogenies…
A: Polyphyletic taxa include groups of organisms that share a common ancestor but also include some…
Q: 4. Draw a cell in each of the following phases. Be sure to represent the major events of each phase…
A: Mitosis is the stage of the cell cycle in which newly formed DNA is separated and two new cells with…
Q: Assume researchers are able to isolate the intact mRNA for a gene called qrs. The qrs mRNA isolated…
A: Messenger RNA is synthesized with the help of RNA polymerase taking the help of template strand of…
Q: Make a table with a scale of absorbance and the concentration of protein in Chromatin sample from…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Step by step
Solved in 3 steps
- Match the terms with their definition. _____ bone marrow a. largest artery _____ spleen b. cardiac pacemaker _____ vitamin K c. source of all blood cells _____ HDL d. inside red blood cells _____ SA node e. carries cholesterol to liver _____ erythropoietin f. hormone made by kidney _____ aorta g. lymphoid organ _____ haemoglobin h. brings blood to left atrium _____ vena cava i. cofactor for clotting factorMatch the type of capillary with the organs/tissue it is found in: A. kidney, intestine, pineal B. muscles, lungs C. liver, spleen, bone marrow D. brain select A B C D 1. continuous capillary select A B C D 2. continuous, with no gaps, wrapped in glial cells select A B C D 3. fenestrated capillary select A B C D 4. sinusoid capillary6. Blood going from the SMALL INTESTINE to the BRAIN would go through all of the following EXCEPT: Dural venous sinu Common carotid artery Aorta Pulmonary artery 7. Blood going from the LEFT FOOT to the RIGHT HAND could go through all of the following EXCEPT: Femoral artery Great saphenous vein External iliac vein Brachiocephalic artery 8. Blood going from the RIGHT FOOT to the LEFT FOOT could go through all of the following EXCEPT: Superior vena cava External iliac artery Right atrium External iliac vein 9. Blood going from the KIDNEY to the RIGHT HAND would go through all of the following EXCEPT: subclavian artery Renal artery pulmonary valve brachiocephalic trunk 10. Blood going from the LEFT HAND to the KIDNEY would go through all of the following EXCEPT: subclavian vein renal artery abdominal aorta brachiocephalic trunk
- 4. Why are the walls of arteries relatively thicker than those of the corresponding Major Systemic Arteries and Veins of the Body 5. Use the key on the right to identify the arteries or veins described on the left. 1. vessel that is paired in the venous system but only a single vessel is present in the arterial system 2. these arteries supply the myocardium 3. the more anterior artery pair serving the brain. 4. longest vein in the body 5. artery on the foot checked to determine to mudount2 oigoi anjev bos ashens circulation of the leg omienni 6. main artery that serves the thigh muscles elect 7. supplies the diaphragm 8. formed by the union of the radial and ulnar veins 9. two superficial veins of the arm smilobasilic 10. artery serving the kidney 11. testicular or ovarian veins 12. artery that supplies the distal half of the large intestine 13. divides into the external and internal carotid arteries Key: anterior tibial 19. major artery serving the skin and scalp of the head 21.…1. Specific cavity where the heart is located A. Aorta 2. Tissue of the heart that attaches to the diaphragm B. Bicuspid or mitral 3. layer that immediately covers the heart muscle C. brachiocephalic 4. middle layer of the heart D. Chordae tendineae 5. Area that grossly demonstrates the separation between the atria and ventricles E. Coronary sinus 6. The two major vessels returning blood to the right atrium F. Coronary sulcus G. Ductus arteriosus 7. Vessel exiting the right ventricle 8. Vessel exiting the left ventricle H. Epicardium 9. Vessels entering the left atrium I. Fibrous pericardium 10. Type of blood carried in pulmonary veins J. Great cardiac vein 11. The temporary shunt in the fetus between the aorta and pulmonary trunk K. Inferior vena cava 12. The name of this structure (#11) in the adult L. Interventricular artery 13. The Myocardial muscular ridges in the atria M. Ligamentum arteriosum 14. The Myocardial muscular ridges in the ventricles N. Mediastinum 15. Valve between…Regarding the collection of blood, which one of the following * ?statements is correct Deoxygenated blood is pumped through the right side of the heart via arteries to all parts of the body. Arterial blood is pumped through the left side of the heart via arteries O to all parts of the body. Oxygenated blood is pumped through the right side of the heart via arteries to all parts of the body. Not all. O
- 2. Put the following structures in the proper order (#1-21) in which blood flows through the cardiovascular system. 1 Right atrium Left ventricle 21 Vena cava Pulmonary trunk Tricuspid valve Systemic capillaries Pulmonary capillaries 19 Systemic venules Pulmonary arteries Right ventricle Aortic valve Aorta Pulmonary veins Mitral valve Systemic veins 17 Systemic arterioles _9_ Pulmonary venules Pulmonary valve Left atrium Systemic arteries Pulmonary arterioles 3. Identify structures of the heart on the following pictures. A. В. C. D. B E. D. F. Н. G I. J. A. B. -E C. D. E. F. G. H. I. J.1. If a person has arteriosclerosis and he is under the coverage of blood thinner what initiative the doctor needs to take before doing any surgical procedure?Match the arteries in column A with the regions supplied in column B. Column B1. jaw, teeth, and face2. larynx, trachea, thyroid gland3. kidney4. upper digestive tract, spleen, and liver5. foot and toes6. gluteal muscles7. triceps muscle8. thoracic wall9. posterior abdominal wall10. adrenal gland11. diaphragm12. lower colon13. brain14. forearm muscles15. knee joint Column A a. anterior tibialb. celiacc. costocervicald. deep brachiale. external carotidf. inferior mesentericg. internal carotidh. internal iliaci. lumbarj. phrenick. popliteall. renalm. suprarenaln. thyrocervicalo. ulnar
- 12. Name and describe the structure, location, and function of the three types of capillaries. Practice by completing the table below. Structure Has HOLES (FENESTRATIONS) in the simple squamous cells? (No OR Yes small holes OR Yes large holes) Has CONTINUOUS BASEMENT MEMBRANE around the simple squamous cells? (Yes continuous OR Yes discontinuous or none at all) Type of organ where found? (Organs that tightly regulate substances exchanged OR Organs involved in filtration, absorption or secretion of hormones OR Organs that "process" large molecules or even cells) Exer Continuous Capillaries Fenestrated Sinusoid Capillaries Capillaries1. Describe how the heart as a muscle does its job of pumping blood. What happens if the cardiac muscle itself does not get enough blood? Using your knowledge of cardiac circulation, explain the flow of blood through the heart. 2. What would cause Aunt May's weakness and shortness of breath during her sudden attack? 3. What is the job of the coronary arteries? What happens to their ability to do their job if they become narrowed by fatty or mineralized deposits?IV. Label the following parts of a blood vessel: А: D B: C: D: E: F: ARTERY 7. V. Describe the following relationships/correlations {Example: one goes pressufe inarases, Ho bressure dearease, fig 2) Resistance and Blood Flow = fesistone increases, 1) Pressure and Blood Flow %3D