Module_1_What_is_a_Gene_Answer_Sheet

TOPIC: PCR and Gene Cloning Basics Question: What are 2 possible roles of CaCl2 in the transformation process?

12e which genes that are normally found in a lambda genome would be deleted in your lambda vector? briefly explain why those lambda genes are normally delete it from your lambda phage being used as cloning vectors.

Primer Development Pick your favorite gene and develop primers for a target within the gene. Provide the following information: Gene name: Species: Accession number: Primer target: Primer Output: Explain why you selected this primer set.

Discuss about Genome 10K Project ?

CA Live Remote Consider the following chart: What type of mutation is this? * DNA: TAC GCA TGG AAT MRNA: AUG CGU ACC UUA Amino acids: Met-Arg-Thr-Leu DNA: TAC GTA TGG AAT MRNA: AUG CAU ACC UUA Amino acids: Met - His - Thr- Leu substitution deletion insertion frameshift mutation

TALENs What is it? And how it works in genome editing? Including additional figures pls At least 1-2 page

Q5. Molecular markers like SSR have phenotypes. What is the molecule on which these phenotypes are seen? What is the technology that allow us to visualize the alleles of these markers? Q6. What replaces the function of helicase in PCR? Q7. Why are primers important in PCR? Q8. What is the principal feature of Taq polymerase that enables of DNA amplification invitro? Q9. What is the most important feature of the thermocycler that makes PCR possible? Q10. Why is ligase not needed in PCR?

Recombination in Sexually and asexually Reproducing Organisms ASSIGNMENT 1. What is the importance of Gregor Mendel's Law of Inheritance in Molecular Biology? 2. What is the importance of Recombinant DNA Technology in the Molecular Laboratory? 3. Describe how DNA moves from cell to cell by: a. conjugation b. transduction c. transformation

ZFNs What is it? And how it works in genome editing? Including additional figures pls At least 1-2 page

Protein Synthesis and Mutation Practice • Complete the lines below by determining the mRNA transcript and amino acid sequence. • Compare the mutant DNA strands to the wild type strand. ⚫ Circle the mutation in the mutant DNA strands and describe the type of mutation (frameshift - insertion, frameshift - deletion, point - missense, point - silent, or point-nonsense). Not all of these will be used in this assignment! Wild type DNA template: 3' TACGCGTGCACGATGCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Mutation #1 DNA template: 3' TACGCGTGCACGATCCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation: Mutation #2 DNA template: 3' TACGCGTGCTCGATGCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation:

Need help    1) Say you have an organism with a genome of 1 thousand bases (103) and a forward primer made up of 5 nucleotides (aka, a 5-mer)   a)How many possible 5-mers are there? Remember that each position in the 5-mer has one of four nucleotides.   b) Pick a 5-nucleotide position at random in the genome: what’s the probability that your forward primer matches there? Focus for now just on one strand of DNA.    c) Pick a random 5-nucleotide position in the genome: what’s the probability that your forward primer does NOT match there? Focus for now just on one strand of DNA.    d) How many physical locations might your forward primer sit in the genome? Focus just on one strand of DNA. Ignore whether or not it matches at a given location. this is one question with different parts. I would really appreciate it if all parts are answered. and I will defiantly rate.

Please make this as SIMPLE as possible Question: regarding to horizontal gene transfer please only discuss what cells are still alive or dead between transformation, trasnduction, and conjugation Be specific when discussing the donor versus recipient cell, and if the donor and recipient cells are still alive after each horizontal gene transfer event is complete

Home Work: • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5' -СТАССТСCGGGTTGACTGСТАССТТССССGGATGCCCAAAAТТСТСGAG-3— :::::::::::: :::::::::::: :::: +3'-GATGGACССССААСТGACGATGGAAGGGCCCТАССGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is happening at each step. (1) température cycle #1

True or False: 1. The 6X HIS tag is required for a eukaryotic protein to be expressed in E. coli 2. BAC vectors are an appropriate choice for cloning cDNAs 3. Cluster analysis of micro-array data groups together mRNAs of similar sequence 4. In genomic DNA, on average EcoR1 restriction sites are more common than Mse1 restriction sites 5. Tags such as HA that are fused to proteins always compromise their function.

Please answer fast Using the cDNA copies of the transcripts from parasite-cells infected with red fluorescence, and cDNA copies of the transcripts from normal cells labeled with with green fluorescence, what color would you predict the well with the ninjurin gene would appear on the microarray?   a-gray b-green c-red d-yellow

Hi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?

3. Animation 12.1: This table shows results from allele-specific oligonucleotide hybridization analyses conducted on three different patients. The analyses all used the same probes constructed to test for the presence of a mutant gene. A plus sign (+) indicates hybridization occurred and a negative sign (-) indicates no hybridization occurred. Patient #1 Patient #2 Patient #3 Probe for normal allele Probe for mutant allele Which patient(s) is/are homozygous for the mutation and which patient(s) is/are heterozygous for the mutation? O Patients #2 and #3 are homozygous and Patient #1 is heterozygous for the mutation. O Patient #2 is homozygous and Patient #1 is heterozygous for the mutation. O Patient #1 is homozygous and Patients #2 and #3 are heterozygous for the mutation. O Patient # 1 is homozygous and Patient #2 is heterozygous for the mutation.

Q4. What is the relationship between the bases displayed when the arrow is pointed to the left versus when it is pointed to the right? Q5. Why do you think the bases are displayed in this way in the Genome Browser?

Human Genome ProjectIn 2003, the Human Genome Project was successfully completed, determining the exact sequence of the entire human genome, which is made up of 3 billion nucleotide base pairs. The data generated from the Human Genome Project is freely available online to anyone. Many pieces of research and innovations stemmed from the HGP, allowing the identifications of 1 800 disease genes. Many of the corporations using the results from the HGP are privately funded, and research is being done for profit even though the HGP results are provided freely. Identify one advantage and one disadvantage of corporate funding and patenting genetic research results.

Explain Shortly. I need help   The emergence of new molecular biology techniques has allowed researchers to determine DNA sequences quickly and efficiently. A) How could knowledge of a DNA sequence be abused? B) How could knowing a DNA sequence be helpful? C) Would you ever consent to having your DNA sequenced. Explain your answer

Q5. In lab 6, you will set up a PCR reaction to yield amplified DNA products of the rpo B(RNA polymerase B) and 16s rRNA genes. In lab 7, you will set up a sequencing reaction using about 40 ng of these PCR products that you will then add a sequencing primer to the sequencing reaction. If a sequencing reaction is set up with a 100-fold excess of primer to the PCR-amplified DNA product you want to sequence, calculate the number of sequencing primers you will need to add to this sequencing reaction. To perform this calculation, assume your 40 ng sample of double stranded DNA is 4,000 base-pairs (bp) long. Using these two variables of your PCR product [length (in bp) and amount (in g, grams)], you can calculate the number of DNA molecules being sequenced with two conversion factors using the formula below: The average weight of 1 bp is approximately ~650 (g/mole)/bp Avogadro’s number which is 6.02 X 1023 molecules/mole The easiest way to solve this problem is to figure out how much one…

U+ 2:24 E * © e * ll 2 U 1.3 billion bases O 2. 300 million bases on 3. 100 million bases 4. 40 billion bases on 5 a. What is(are) the difference(s) between orthologs and paralogs? b. What are the main sources of variation? red I out of I 个 TOP II !!

Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…

Primers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAA

Layout References Mailings Review View Help 23. Describe each type of transposon and how they integrate into the DNA. How are transposons responsible of antibiotic resistant bacteria?

10:25 Name_ Bio320 What is lignin and its role in plants? Why can reducing the amount of lignin in trees enhance the efficiency of cellulostic-ethanol production? Why can't trees be genetically engineered without any lignin at all? 5Gº Why are transgenic approaches rather than traditional breeding being used to create trees with altered levels of lignin? Where can you find the only company in the USA that makes transgenic trees that are found in forests? Go to this company's website. What type of endangered tree are they trying to survive? AA moodle22-23.coastal.edu

EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? 5- AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC -¹3

LO65 Compare methods that Covid tests and Covid vaccines use. What should the mRNA molecule of a regular mRNA vaccine contain to be translated accurately by our cells? a-Manking UTRS b-alternative codont c-DNA template strand d-promoter e-poly A tail f- S cap    asap please

Q4) What are the 3 main components required for cloning? Q5) What is 16S rDNA, and why would cloning it be useful? Q6) How big is the 16S rDNA ‘amplicon’ we would be cloning?