Q: Compared to pretraining, adaptation to aerobic training results in O a decrease in maximal Q due to ...
A: Aerobic exercise helps in increasing the circulation in heart, lungs and blood vessels and strengthe...
Q: In cell counting, why do you need to calculate for the volume of media needed after computing the ce...
A: The cell enumeration is important for seeding the appropriate cell density into the media flask.
Q: Question:- 1.How is morphology related to food collection in protobranch and lamellibranch subclass...
A: Bivalves: it belongs to class bivalvia and phylum mollusca. It is called as bivalves because it's sh...
Q: virus has a negative‐sense RNA genome, what enzymatic activity (if any) will be found as part of the...
A: Answer :: 2. You know before a virus has a negative sense RNA genome, you mist know the positive sen...
Q: Catabolism of and contribute the most to production of nitrogenous waste. phospholipids; glycolipids...
A: ANSWER;- Catabolism of proteins and nucleic acids contribute the most to the production of nitrogeno...
Q: Collembolans Question 1 options: are arachnids are members of the Paleoptera are hexapo...
A: Answer :- Collembolans are arachnids. Explanation :- Collembolans are the crude Apterygote (wingl...
Q: In the following picture, the differences in phenotype are due to: Genotype Shoot A1A1 Growth A1A2 R...
A: Phenotype The visible character of an organism which is a result of expression of gene is known as ...
Q: Microorganism Type of Microorganism Gram Stain Shape Tryptic Soy Agar McConkey Agar Blood A...
A: *Bascillus cereus is facultative anaerobic bacteria which stains gram positive and shape is rod shap...
Q: when is erythropoietin release stimulated?
A: Erythropoietin is well-known defined as they are been a hormone produced primarily by the kidneys. T...
Q: Based on the give question (PpYyRr * Ppyyrr) (SEE IMAGE), compute the following probabilities. Show ...
A: We are allowed to do upto 3 subpart of a question. Please repost the undone question again. Thank y...
Q: In mice, gene A is epistatic to gene B. Dominant allele "A" allows for pigment to be transported to ...
A: We would expect albino mouse from "aaBb" genotype . Option b is correct.
Q: What is GABA (gamma-aminobutyric acid)?
A: GABA is created which is well known to state that they are been from glutamate by combining glutamat...
Q: What type of regulation would be expected when anaerobic metabolism is occurring in the muscle? Sele...
A: At the onset of exercise, the increase in metabolic demand of the muscles is fueled "anaerobic" met...
Q: Based on the five major classes of antibodies given below, which of the following is present on the ...
A: Based on the five major classes of antibodies given below, which of the following is present on the ...
Q: Section 2.3 Assignment: Fun 19. Proteins that stick out of the cell membrane and allow cells to reco...
A: 19) These proteins which comes out of the cell membrane and helps in the recognition of the foreign...
Q: Chimpanzees and humans appear very much alike because of? *
A: Which describes the modern classification system? a. based on evolutionary relationships The modern ...
Q: Briefly describe how the components of the cytoskeleton filaments get to the right location in the c...
A: INTRODUCTION It is a complex of filaments and tubules that is mainly enlarged all around t...
Q: How does gas exchange systems facilitate the exchange of gases between the environment and the cells...
A: gas exchange systems facilitate the exchange of gases between the environment and the cells of organ...
Q: Which of the following is most likely to increase secretion of antidiuretic hormone (ADH)? Abnormall...
A:
Q: a.Explain the production of chymosin in a prokaryotic vector and the problems encountered in its pro...
A: Chymosin is also known as Rennin. It is a proteolytic enzyme which is related to pepsin that synthe...
Q: If Aj represents an allele at one locus and B, represents an allele at another locus, which equation...
A: Introduction : In a random mating population gene and genotype frequency is remain constant for gen...
Q: How does the interaction of the Down Syndrome affect’s your cell’s ability to undergo endocytosis an...
A: Down syndrome is caused by trisomy 21 the person has three copies of chromosome 21, instead of the u...
Q: Find an article that pertains to ethics and the health care professional. This might include a relig...
A: Article summarization- This is an article about medical malpractice litigation.i.e., an Ohio doctor ...
Q: B. Study the pictures below and explain how they affect the chain of infection. 3. 2.
A: Chain of infection It is a chain that shows how diseases spread. It mainly contains three things the...
Q: Which of the following structures is not an example of a connective tissue? A. Blood B. Neuron C. C...
A: Cells of animal body that are similar in origin, structure and function are organised to form struct...
Q: Which of the following statements about the circulatory system is false? A. Blood in the aorta is ox...
A: Option A and Option B are True because:- Largest artery is the aorta, which connects to the heart ...
Q: . Compare and contrast the pathways of anaerobic cellular respiration to aerobic cellular respiratio...
A: Cellular respiration in simply terms, is the set of metabolic processes by which organism produces c...
Q: Which of the following statements is incorrect about the rules in biological nomenclature? a. Order ...
A: Binomial nomenclature is the biological system of naming the organisms in which the name is composed...
Q: Use the chart below to help answer this question. Jessica's mother has the blood type AB and her fat...
A: Blood group is an example of multiple allele. It is controller by A, B and O alleles.
Q: Suppose the figure below represents a cross section of a woody tree. What could be the age of this p...
A: After the primary growth, the increase in grid or thickness of plant parts due to the formation of s...
Q: lease helpp
A: One of an important human behaviour which affects respiratory system is SMOKING.
Q: [ summary ] current or ongoing research about mungbean
A: Use of Phenomics for Differentiation of Mungbean (Vigna radiata L. Wilczek) Genotypes Varying in Gr...
Q: 1. 2. 3. 5. 6. 7. 8. Question 3: Name the process in the below image and define the annotated stages...
A: The images shown above shows the process of mieosis. The meiosis is the process of division of the c...
Q: Question 3 Two pure breeding lines of pea are crossed. One is purple-flowered and tall, the other wh...
A: “Since you have asked multiple question, we will solve the first question for you. If you want any s...
Q: Before, plant breeding was done by crossing the genes of two plants with desirable characteristics. ...
A: Transgenic plants: Plants that have been genetically edited have been used for scientific research,...
Q: Match the following letters to the designated number.
A: Epithelial cells are held together by strong anchoring junctions.
Q: What type of signalling does aldosterone have? (autocrine, endocrine, paracrine, synaptic, cell-cell...
A: Aldosterone is a mineralocorticoid steroid hormone best known for its effect on sodium reabsorption ...
Q: What is meant by autoregulation of blood flow and what is the mechanism involved
A: autoregulation of blood flow is regulated by neuro hormonal factors, physical pressure, endothelial ...
Q: Draw a diagram that illustrates the typical events that would need to occur in order for a secreted ...
A: Insulin, which is generated by β-cells, is an important metabolic regulator. Insulin is synthesized ...
Q: QUESTION 3 Why is sodium actively reabsorbed in the nephron? To decrease blood pressure To decrease ...
A: The kidney is the excretory organ that maintain water balance in our body. It is responsible for the...
Q: 5. When blood samples are collected, they are often centrifuged to separate the components of the bl...
A: Normal blood sample contains 4 components - Red blood cells white blood cells platelet ...
Q: What is the explanation for enzyme specificity?
A: All biological chemical reaction reactions in living organisms are controlled by enzymes. If enzymes...
Q: Which of the following could result in a polyphenism? A mutation creates a deleterious version of an...
A: Polymorphism is heritable. It is the ability of object to take many forms. Polyphenism is a type of ...
Q: Aside from H&E, what other staining methods are applicable in Golgi apparatus, mitochondria, and nuc...
A: Answer :- Subsequent to trying different things with presenting cells to gold and mercury, Golgi uti...
Q: do you continually need to be bringing in essential substances into the body a
A: Every organisms including humans need some of the essential substance for an healthy life. There are...
Q: List the components of an x‐ray machine and how they contribute to the formation of an image
A: NOTE:- Since you have asked multiple questions, we will solve the first question for you. If you wan...
Q: Which of the following statements regarding microbial death is FALSE? Question options: cell...
A: Microbial death is defined as the permanent loss of reproductive capacity of microbes under ideal en...
Q: Sustentocytes Select one: a. produce follicle-stimulating hormone. O b. nourish spermatocytes and as...
A: Spermatogenesis It is the process of production of sperm cells in male reproductive system.
Q: What performance quality tests do we need to design and manufacture a patient turning apparatus show...
A: Constant pressure on bony prominences such as the occipital, shoulder, sacrum, and heel causes a pre...
Q: The Microorganisms that will be studied in this course includes representatives of all microscopic l...
A: Microorganisms are microscopic organisms exists as unicellular, multicellular or clusters of cells. ...
write a short discussion
Step by step
Solved in 2 steps
- Scientists are investigating the human DNA (A strand of human DNA is 2.5 nanometers in diameter). a. Consider an ideal scanning electron microscope (neglect all aberrations and electron-sample interactions) operating at 2 kV. i. k What is the electron wavelength? What is the resolution of the microscope? Can this microscope be used for the resolution of the ii. [ iii. ! human DNA? b. What is the main difference between Scanning Electron Microscope and an Optical Microscope? c.[: Can they determine the structure of the the human DNA using optical microscope? Explain your answer.Each group will be provided with 20 g double-stranded DNA oligomer in STE buffer (0.1M NaCl/ Tris/ 10 mM EDTA, pH 7.4). The sequence of one strand of the oligomer is: 5’-AATGGTACGTATACTTTAT-3’ - show a table of % denaturation of DNA at different temperatures, using the equation provided in “Calculation” - plot a graph of % denaturation of DNA vs different temperatures with clear label and title, and hence determine the experimental Tm of the DNA sample - calculate the theoretical Tm of the sample using Marmur and Doty equation, compare the experimental Tm with theoretical Tm of the DNA sample5) Using FRAP (Fluorescence Recovery After Photobleaching), you can measure the diffusion rate of membrane proteins. You attach a fluorescent marker to your protein of interest, bleach a small region of the cell membrane with an intense laser light, and determine the time it takes for the bleached spot to recover fluorescent signal (see figure below). (a) (b) Bleach Laser bleaching of fluorescent marker Fluorescence intensity recovery Recovery Time How would the recovery time of your protein change if the membrane contained a higher concentration of unsaturated fatty acids? Why? How would the recovery time of your protein change if you conducted the experiment at a lower temperature? Why? How would the recovery time of your protein change if it were anchored to the membrane skeleton? Why?
- Hoechst 33342 is a membrane-permeant dye thatfluoresces when it binds to DNA. When a population ofcells is incubated briefly with Hoechst dye and then sortedin a flow cytometer, which measures the fluorescence ofeach cell, the cells display various levels of fluorescence asshown in Figure Q17–1.(MB = methylene blue) What is the concentration of the sample of the substance with the reporter absorbance of 0.40 at 595 nm?Why does a dual layer of Cr/Au (20/100nm) delaminate during a GSTAT electrochemical polymerization of Pedots;pss
- Two co-op students at your start-up company have been asked to evaluate the rate of reaction occurring in a transparent gel particle containing immobilized mouse melanoma cells. The equation for the reaction rate ris is: Vmax T'As Km+CAs where R=3.2 mm, Vmax= 0.12 gmol s' m3, CAS = 41 gmol m3, and Km=0.8 gmol m3. One student reports a reaction rate of 1.6x10 gmol st; the other reports 1.6x10 1º gmol s1. You left your calculator on the bus this morning, but must know quickly which student is correct. Use an order-of- magnitude calculation to identify the right answer. Which student is correct?Fluorescence confocal microscopy (FCM) - STK38 monoclonal antibody (M01), clone 2G8- 1F3. a. b. 200 μm What is the basic principle of image formation using this microscopy technique? What can be observed and concluded from the image of the specimen?Can you please help me with question( 9) 5. In the film, Dr. Jablonski explains that melanin, located in the top layer of human skin, absorbs UV radiation, protecting cells from the damaging effects of UV. Genetics determines the type of melanin (i.e., brown/black eumelanin or red/brown pheomelanin) and the amount of melanin present in an individual’s cells. Based on this information, write a hypothesis for where in the world you would expect to find human populations with darker or lighter skin pigmentation (i.e., different amounts of melanin). 9. Do these data support your hypothesis from Question 5? Justify your answer.
- Answer: giycogen Time left 0:4T:- If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. GCGCGCGCGCGCGCGCGCGCG O b. GGGGGCCCCCAATTCCCCCCC O c. AAAAAATTTTTCCCCCGGGGG O d. ТAСТАСАСTGTGGTTAАТТААА Oe. АТАТАТАТСGСGTTAAATTCTА CLEAR MY CHOICE Match the given words with the most suitable words from the given list. Unicellular fungi Hyphae Choose... Охуgen Atom ENG سطح المكتبSketch the appearance after visualization of a protein mixture containing the seven proteins (fibrinogen, y-globulin, collagen, ovalbumin, myoglobin, hemoglobin, insulin) when subjected to two-dimensional (2D) gel electrophoresis.Remaining Time: 40 minutes, 15 seconds. v Question Completion Status: A Moving to another question will save this response. Question 35 "If a DNA molecule has 12% thymine, how much guanine will it have?" 12% 24% 38% 76% A Moving to another question will save this response. MAR