With what region of the promoter does the theprincipal interaction between it and the RNApolymerase occur in a closed complex-10 regionO -35 region Your supervisor asks you to carry out an in vitrotranscription reaction. Unfortunately, they arecalled away from the lab before they can tell youwhich tube contains the polymerase enzyme. Youlook in the freezer and find four tubes withsomewhat cryptic labels. Which tube would youuse?α,ββ'εθ( αεθa2BB'Wa2BB'wo

Name: With what region of the promoter does the theprincipal interaction be
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: With what region of the promoter does the theprincipal interaction between it and the RNApolymerase occur in a closed complex-10 regionO -35 region Your supervisor asks you to carry out an in vitrotranscription reaction. Unfortunately, they arecalle

Note: As Per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: The…

Answered: With what region of the promoter does…

Science

Biology

With what region of the promoter does the the principal interaction between it and the RNA polymerase occur in a closed complex O -10 region O -35 region

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 2P: The Events in Transcription Initiation Describe the sequence of events involved in the initiation of...

See similar textbooks

Similar questions

The Events in Transcription Initiation Describe the sequence of events involved in the initiation of transcription by E. coil RNA polymerase. Include in your description those features a gene must have for proper recognition and transcription by RNA poIymerase.
With what region of the promoter does the the principal interaction between it and the RNA polymerase occur in a closed complex -10 region O -35 region
The RNA polymerase from bacteriophage T7 diff ers structurally from prokaryotic and eukaryotic RNAPs and is extremely specifi c for its own promoter. Why do these properties make T7 RNAP useful in experiments with recombinant DNA?
Usually found in prokaryotes, regulatory sequences lying adjacent to the DNA being transcribed are composed of a promoter located next to a(n)_ that interacts and is controlled by regulatory protein. (A rho binding domain (в) ТАТА box c) operator D RNA polymerase holoenzyme
GACA CAAT box A site P site E site DREASAARE III III III III III factors and RNA pol to bind to in order to activate gene expression. Accepts charged tRNA molecules whose anticodon complements the codons of mRNA. Holds a nascent elongating polypeptide before final release. Unique sequence found in bacteria between TATAAT and START. 5 upstream consensus motif that is easily melted for transcription purposes in prokaryotes.
mRNA sequence of A gene Find 5’ UTR and 3’UTR of mRNA 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’
TRUE FALSE EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in prokaryotic translation. The sigma o subunit of RNA polymerase is replaced by NusA to recognise the promoter region of a gene. The -10 and -35 sequences in E. coli DNA are referred to as untranslated region. In human, translation begins before transcription of an mRNA completes. The distal histidine stabilises the iron in heme group of a deoxyhaemoglobin. Receptor for epinephrine consists of seven transmembrane helices. Membrane receptors bind to hydrophobic signaling molecules. Amino acids, glucose and fatty acids are taken up by transporters into liver cells. Glycerol and fatty acids are synthesized from the intermediates of glycolysis. Synthesis of fatty acid occurs in cytoplasm. Triacylglycerol can be obtained from diet and also synthesized in liver cells. Ammonia and keto acid are formed in transamination.
5' 3' ORF for gene X The sequence for gene X above has a hypomorphic mutation (which you name Mutation #1) that is not indicated on the diagram. Based on the experimental data below, what specific sequence element is the mutation most likely in? Wild Type Northern Gene X O -10 region O 3' of the ORF ribosome binding site O -35 region Mutant O within the ORF Wild Type Western Gene X direction of transcription Mutant 3' +1 5'
Identify the DNA elements and protein factors, #1-7, in the figure below that are involved in the initiation and elongation of transcription at a eukaryotic promoter of a gene TRANSCRIPTION ON RNA PROCESSING PefA A eukaryotic promoter commonly includes a TATA box (a nucleotide sequence TRANSLATION Ritoom containing TATA) about 25 nucleotides upstream from Nontemplate (coding) strand of DNA 7 Pupeptide 1 the transcriptional start point. Nontemplate (coding or sense) strand DNA TATAAAA ATATILTI 5 2 3 Start point 2 Several transcription TCCAA 3' 5' factors, one recognizing the TATA box, must bind 3' end to the DNA before RNA 4 polymerase Il can bind in the correct position and orientation. UCCA 3 5' 3' 3 Additional transcription GGTT factors (purple) bind to the DNA along with RNA 5' Direction of transcription polymerase II, forming the transcription initiation 3 complex. RNA polymerase Il then unwinds the DNA double helix, and RNA synthesis begins at the start point on the temple strand.…
(a-32P) GMP INCORPORATED (pmol) N 111 (a) (b) (c) 20 5 (min) 26 10 The image above shows an experiment to investigate the effect of TFIIS on transcription by RNA polymerase II. Why were NTPs added to the reaction last?
A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its wil-type composition= lys-ser-pro-ser-leu-asn-ala-ala-lys mutant form= lys-val-his-his-leu-met-ala-ala-lys. Decipher the segment of mRNA for both the original protein and the double mutant. Which base was added? Which was deleted?
From the list given - choose all the regulatory sequences that you think would control the expression of this eukaryotic gene THERE are multiple answer for this that I can choose Group of answer choices A 3' UTR B PPE sequences C 5' UTR D introns E core promoter F coding sequence G DNA-bending protein H enhancer sequence I mediator protein