Why test that mice infected with B. anthracis produce antibodies to the S-layer proteins? What is the point, what does it tell us? (figure 6) I need help finding the answer in the article and answer as short a possible link to
Q: Define Genome, Transcriptome, and Proteome. Include examples of each one and a very detailed…
A: Rapid advancements in science and technology have enabled various scientists and others to research…
Q: Genetic expression involves transcription and translation. Match the structure or molecule to the…
A: We all know that central dogma is a very basic and important procedure in every cell.There are…
Q: 7-Moulds and yeast related to: A-Bacteria B-Viruses C-Parasites D-Fungi
A: Molds feed on dead plant or animal tissue. They are a part of our natural environment and can be…
Q: discussion on obejective lenses: screening, low and high power objectives in whitefish blastula
A: A microscope is a device that generates magnified pictures of small objects, allowing the viewer to…
Q: Human immunodeficiency virus entered human populations after evolving from a simian immunodeficiency…
A: Human immunodeficiency virus (HIV) is a virus that attacks the immune system, specifically targeting…
Q: 1. How are the endocrine and nervous systems similar? How are they different?
A: The endocrine system includes the endocrine glands that secrete substances. These are called…
Q: Micorgnathozoans are characterized by (check all that apply) - dorsal plates -…
A: A class of tiny marine organisms known as Micrognathozoa often measure less than 1 millimeter in…
Q: Do you find the arguments for the continuance of eating meat by humans compelling? What are the…
A: There is no question that meat has played a fundamental role in the evolution of humans. Our…
Q: Video #2 states that trees can take in CO2 from the atmosphere and store it in wood of the trees as…
A: Trees and green plants are all responsible for removing carbon dioxide from the atmosphere in the…
Q: Place each box in the appropriate column. (Each box is used only once.) Phenotypic ratio of the…
A: Introduction : Punnett square is a square diagram. The genotypes of a specific cross or breeding…
Q: If the proband (III-2) marries a heterozygous woman, what is the probability that they will have a…
A: Autosomal dominant inheritance is a type of inheritance where the presence of a single dominant…
Q: Chi-square analysis to determine whether you are correct as to the genotype of the unknown…
A: Hypothesis: The genotype of the unknown individual is homozygous recessive (aa). Degrees of Freedom…
Q: How many meiotic divisions are required to produce 76 seeds in a Guava fruit?
A: Guava: The common tropical fruit guava is grown throughout many tropical and subtropical areas.…
Q: 10) 0.031709792 11) Convert one million seconds to years. (1 yr with 365 days) 12) Convert 12 liters…
A: These are conversions. In order to convert a numerical value from one unit to the other one should…
Q: You perform an experiment, in which you inoculate bacteria into a medium that contains glucose and…
A: Introduction : Bacteria grown in media with two different types of sugars—one monosaccharide and one…
Q: Discussion on cell division in onion root tip cell
A: The type of cell division studied in onion root tip cell is mitotic cell division. There are 8 sets…
Q: What property of water helps retain heat in the water when air temperature drops? cohesion…
A: Introduction : The energy absorbed during the process in which a material in the liquid state is…
Q: You have two true-breeding plants, one with blue flowers and one with red flowers. You cross these…
A: Inheritance can be defined as a transmission of characteristics from parents to offspring or from…
Q: List examples of the synthetic, metabolic, and excretory functions of the kidney
A: Understanding the functioning of the body's systems is essential for several reasons. By…
Q: DNA Nano measurements: width of the helix, spacing between nucleotides Use the functional groups…
A: My synthetic nucleotide would have a thymine base connected to a deoxyribose sugar and a phosphate…
Q: A person goes for a 5km run. After about 5 minutes of exercise, their blood glucose levels begin to…
A: Through a process known as homeostasis, animal organs and organ systems constantly respond to…
Q: Describe and give an example of each of the following: a. Commensalism b. Mutualism c. Parasitism
A: Introduction : A field of science called ecology includes the domains of human science, population,…
Q: In peas, tall (T) is dominant to short (t). A homozygous tall plant is cross with a short plant. The…
A: Introduction : Punnet square is a figure that shows many genotypes that could occur in progeny…
Q: -Dna Extraction
A: Thesis Topic: Investigating the genetic diversity of a rare species of plant using Restriction…
Q: Importance of Understanding the Scientific Method 5. Why are the following critical to the validity…
A: For scientific study, proper understanding of the topic is needed. There are few steps which should…
Q: Indicate which of the following descriptions does not apply to the biochemical depicted here: O=d-0…
A: The DNA is a double-stranded molecule. Each strand is made-up of a sequence of four bases A, T, G,…
Q: Do free-living amoebae cause illness in man? If so, enumerate some of these opportunistic amoeba and…
A: Introduction: Acanthamoeba spp., Balamuthia mandrillaris, Naegleria fowleri, and sappinia are…
Q: Please discuss various methods of gene regulation in prokaryotic cells including the lac operon, the…
A: Prokaryotic cells, such as bacteria, have evolved a variety of mechanisms to regulate gene…
Q: For each of the following sentences, fill in the blanks with the best word or phrase selected from…
A: The cytoskeleton is extended throughout the cytoplasm of the cell. It is a complex network of three…
Q: Explain how the temperature of the human body is regulated
A: Maintaining constant bodily conditions is part of homeostasis. The stability of the environment is…
Q: What are the differences between acute and chronic amoebiasis?
A: Humans gastro-intestinal system infections like amoebiasis are rather prevalent. Environment is less…
Q: Definition of morphology should capture every bit of important information.
A: Since morphological traits specific to a certain species are used to identify it, morphology is…
Q: how are methods of analysis in epidemiology determined?
A: Epidemiology helps us understand the distribution of diseases in a population, including factors…
Q: 8. A 1998 study published in the British medical journal, The Lancet, claimed that child…
A: Childhood vaccines, also known as immunizations, are a safe and effective way to protect children…
Q: s CF respectively? Punnett Squares “So, what’s next?” asked Mike. “First, we’ll collect DNA…
A: Cystic fibrosis is inherited in an autosomal recessive fashion. This means that when two recessive…
Q: discuss the significance of epidemiological studies… provide an example to support your discussio
A: An epidemiological study is a research method used to investigate the distribution and determinants…
Q: Outline the pathogenesis of Myasthenia gravis and the consequential effects from the disruption at…
A: A severe autoimmune, nerve and muscle condition known as myasthenia gravis results in weakness in…
Q: A bacteria culture starts with 140 bacteria and grows at a rate proportional to its size. After 5…
A: Given that the starting population of bacteria is 140 and it grows at a rate proportional to its…
Q: transmission of pain from the periphery of the body to its perception in the brain.
A:
Q: Directions: Given the DNA strand below. Decode the hidden message in the proteins that will be…
A: DNA is the genetic material seen in most of the organisms. DNA is double helix structure which…
Q: 1. Differentiate Polyspecific AHG from Monospecific AHG. 2. What are the uses for Direct and…
A: Globulins are high molecular weight, water-insoluble proteins in the blood that plays an important…
Q: Describe the function of electrochemical immunosensors and how it can work on patients to detect it…
A: An affinity biosensor known as an immunosensor relies on associations between a particular antigen…
Q: DNA: Using the two deoxynucleotides you chose, draw the two monomers bound together into a compound,…
A: In deoxynicleotides, carbon number four of sugar moeity has a hydrogen group attached to it while in…
Q: 2. A professional Women's Hockey League (WHL) player is illegally cross-checked by an opponent from…
A: Our kidney plays a major role in maintaining our normal blood pressure. Damaged kidney arteries…
Q: Describe the most common type of genetic variability.
A: Genetic variability is the presence of variation in the genetic makeup of the organisms that leads…
Q: How do you convert 50 umol/ml*sec to M/sec ?
A: Molarity (M) is a term given to quantify a substance in terms of mole/l in its standard form. But,…
Q: 4. What is coevolution? Provide an example of predatory-prey coevolution.
A: Introduction : Evolution is the process by which the traits of the species change over the course…
Q: define epidemiology. differentiate in detail between environmental epidemiology and occupational…
A: Epidemiology is the study of the distribution and determinants of diseases and health-related states…
Q: TRUE OR FALSE High altitude training increases in red blood cell mass and the amount of hemoglobin…
A: Blood arteries in the circulatory system move deoxygenated blood from and oxygenated blood toward…
Why test that mice infected with B. anthracis produce antibodies to the S-layer proteins? What is the point, what does it tell us? (figure 6)
I need help finding the answer in the article and answer as short a possible
link to article: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC106848/
Step by step
Solved in 2 steps
- what is plaque essay? what is the purpose of this lab? why this lab is perform? (bacteriophage) what techniques is used and how can we derive information(data)? methologies, theory, mechanism for reactions that lead to observable results. required information on microbial metabolism. why is the microbe doing this?You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTDifference between Capsule and Microcapsule in bacteria.
- of bacteria. The Gram stain works because of differences in the O 1) cell membranes O 2) genetic characteristics O 3) capsules O 4) antigens O 5) cell wallsQUESTION 10 You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCG GCGAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTWhat is the group of bacteria found in both the rumen of cattle and shidge of sewage treatment?Please provide the answer with a plagiarism-free proper explanation. Kindly also refer to the NCERT 12th Biology.
- What is meant by the term "staphylococcus"? O Bacteria that are round and arranged in clusters Bacteria that are round and arranged in chains Special bacteria that are spiral-shaped O Bacteria that are rod-shaped and found in groups Which of the following is false regarding a DNA molecule? It contains a double helix structure It stores genetic information It contains the nitrogen base Uracil It contains base pairsAll of the following are possible configurations of bacteria EXCEPT? Monococcus O Streptococcus Diplococcus OLactobacillus Which of the following is NOT an accessory organ in the digestive system? Liver Pancreas Duodenum Gall bladderDiscuss the contributions of Lister, Pasteur, and Koch to the germ theory of disease and the treatment or prevention of diseases. What other contributions did Koch make to microbiology?
- Characterize and give a brief description of the following bacteria: Bacteriodes fragilis Streptococcus mutansWhat is meant by the term “staphylococcus”? Bacteria that are round and arranged in clusters Bacteria that are round and arranged in chains Special bacteria that are spiral-shaped Bacteria that are rod-shaped and found in groupsNaming and Classifying Microorganisms 1. Recognize the system of scientific nomenclature that uses two names: a genus and a specific epithet. 2. Differentiate the major characteristics of each group of microorganisms. 3. List the three domains. A Brief History of Microbiology 1. List at least four beneficial activities of microorganisms. 2. Name two examples of biotechnology that use recombinant DNA technology and two examples that do not. 3. Explain the importance of observations made by Hooke and van Leeuwenhoek. 4. Compare spontaneous generation and biogenesis. 5. Identify the contributions to microbiology made by Needham, Spallanzani, Virchow, and Pasteur. 6. Define bacteriology, mycology, parasitology, immunology, and virology. 7. Explain the importance of microbial genetics and molecular biology.