Which statement most accurately describes the ‘backbone’ of DNA? Group of answer choices The DNA strand is wound up around histone groups which gives the backbone structure to the chromosome The sugar group from a nucleotide is connected to the next sugar group via a phosphate group The hydrogen bonds between nucleotides are quite strong and provide structure to DNA. Adenine and Thymine, and Guanine and Cytosine are linked together

Which statement most accurately describes the ‘backbone’ of DNA? Group of answer choices The DNA strand is wound up around histone groups which gives the backbone structure to the chromosome The sugar group from a nucleotide is connected to the next sugar group via a phosphate group The hydrogen bonds between nucleotides are quite strong and provide structure to DNA. Adenine and Thymine, and Guanine and Cytosine are linked together

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 13QP

See similar textbooks

Similar questions

Which of the following statements regarding DNA is false? Features a beta glycosidic bond between deoxyribose and nucleobase. Phosphoester bonds in DNA are extremely stable to non-catalytic hydrolysis. In B DNA the parallel stacks of nucleobases are separated by about 3.5 A A DNA is formed from single strands of RNA and DNA DNA contains uridine, adenosine, guanosine, and cytidine as nucleobases.
Based on your understanding of DNA structure thus far, design a synthetic nucleotide that can be integrated into a DNA molecule AND be functional. Take the following into consideration: DNA Nano measurements: width of the helix, spacing between nucleotides Use the functional groups that you’ve learned about Remember that hydrogen bonding stabilizes the DNA molecule
Part A Make a concept map that relates DNA's primary structure to its secondary structure. Label the diagram by dragging the labels to the appropriate targets, DNA's secondary structure hydrophobic interactions phosphodiester linkages deaxyribonucleotides Pyrimidines antiparallel double helix DNA's primary structure purines complementary base pairing Submit My Answers Give Up jained by make up including two rings held together by single ring arranged in pairs make up held together by Reset Help
Which of the following combinations is nucleotide molecule? The nitrogenous base uracil bonded to ribose and phosphate complemented with the addition of a water molecule A nucleoside resulting from the dehydration reaction between two phosphates, glycerol, and an unsaturated fatty acid. The DNA backbone consisting of three phosphate groups, a 5-carbon nitrogenous base, and a nitrogen-containing sugar residue An ATP molecule is formed by combining adenine, ribose, and three inorganic phosphate groups
The template strand of a double helical segment of DNA consists of the following sequence: 5’- GTAGCCTTATCTAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACCATGTATAGTTG-3’ Use the given data to answer the succeeding questions and always indicate (and pay attention to) the DIRECTIONALITY of the strands in your answers. Part I. What is the nucleotide order in the complementary DNA strand? Part 2. What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? Part 3. What will be the overall anticodon sequence in tRNA? Part 4. Following the transitional process, what is the amino acid sequence that will be coded for? Show your answer using ONE-letter amino code starting from N-terminus to C-terminus Part 5. Following translational process, what is the amino acid sequence that will be coded for? Show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus.
What bonds form the backbones of DNA molecules? O Bonds between complementary nitrogenous bases O Bonds between the phosphate group of one nucleotide and the phosphate group of the previous nucleotide O Bonds between the nitrogenous base of one nucleotide and the sugar of the previous nucleotide Bonds between the phosphate group of one nucleotide and the sugar of the previous nucleotide
Write out the DNA sequence using the following instructions: This is a double stranded DNA hydrogen bonding with each other following the principle of complementary base-pairing Each strand contains ten nucleotides Each strand contains all four different types of nucleotides You should indicate clearly the directionality of each strand in your answer You do not need to draw the full nucleotide structure. Use the one-letter code (A, T, G, C, or U) to represent each nucleotide
DNA: The Secret of Life https://www.youtube.com/watch?v=HwPWv50YcMY There were three main groups working to discover the structure of DNA. Who were the three different teams and what techniques were they using?
In the DNA structure, a purine molecule always binds with a pyrimidine molecule. How would you expect the structure to differ if Adenine forms base pairing with Guanine and Cytosine forms base pairing with Thymidine? Instead of A-T, G-C; can it be A-G, C-T? Justify your answer within five sentences
Select the phrases that accurately describe properties of the most common form of the DNA double helix. DNA contains equal amounts of adenine and thymine and equal amounts of cytosine and guanine. The nitrogenous bases are exposed to the solvent, whereas the sugar-phosphate backbone of each nucleotide strand is in the interior of the double helix. The phosphodiester bonds between nucleotide residues run in opposite directions in the two strands. Base pairs have a spacing of 3.4 Å. A helical turn consists of about 3.4 base pairs.
Which of the following statements about the DNA double helix is FALSE? O The base pairs are located in the center of the helix O The plane of the base pairs is perpendicular to the direction of the deoxyribose- phosphate backbone O The two strands have the same 5' to 3' direction (i.e, are parallel) O The base pairs stack on one another O The deoxyribose-phosphate backbone is on the outside of the helix
Which of the following statements about the structure or composition of DNA is FALSE? O DNA is a double helix Complementary base-pairing occurs between pyrimidine and purine bases O The amount of thymine closely approximates that of guanine within a particular organism O The base-pairing is mediated by hydrogen bonding O Adenine pairs with thymine and guanine with cytosine