Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute myleoid leukaemia? A. t(8;21) translocaton (RUNX1_RUNX1fusion) B. DNMT3A mutation C. TP53 deletion D. NPM1 mutation.

Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute myleoid leukaemia? A. t(8;21) translocaton (RUNX1_RUNX1fusion) B. DNMT3A mutation C. TP53 deletion D. NPM1 mutation.

Name: Which ONE of the following molecular abnormalities is associated with
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute myleoid leukaemia?A. t(8;21) translocaton (RUNX1_RUNX1fusion)B. DNMT3A mutationC. TP53 deletion D. NPM1 mutation.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter12: Genes And Cancer

Section: Chapter Questions

Problem 20QP: Can you postulate a reason or reasons why children with Down syndrome are 20 times more likely to...

See similar textbooks

Similar questions

Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute myeloid leukaemia Select one: A.t(8;21) translocation (RUNX1‐RUNXT1 fusion) B.DNMT3A mutation C.TP53 deletion D.NPM1 (nucleophosmin) mutation
Although slow acting retroviruses lack oncogenes, retroviral infection can activate proto oncogenes leading to oncogenesis. a. Describe the mechanism of proto-oncogenes activation that can result from with infection with slow acting retroviruses. b. In what other ways can proto-oncogenes be converted to oncogenes?
Which ONE of the following genetic patterns defines a patient with acute myeloid leukaemia with the most favourable prognosis? Select one: A.Deletion of chromosome 5 B.Normal karyotype with FLT3 tyrosine kinase domain mutation C.t(8;21) translocation D.Deletion of chromosome 7
Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A. mucopolysaccharidosis type II B. Turcot syndrome C. Haemophilia A D. Xeroderma pigmentosum E. Haemophilia B F. Ataxia Telangiectasia G. Noonan syndrome H. Li-fraumeni syndrome I. Hunter syndrome J. Ocular motor apraxia
For the following diseases, describe the best technique for diagnosing them. Please make sure you include how you would tell someone with the disease from someone without the disease. B. Factor V Leiden thrombophilia is caused by a point mutation at position 1691 in exon 10 of the Factor V clotting factor gene that changes an arginine into a glutamine. This change removes one of the cleavage sites for activated protein C and leads to an increased tendency to clot.
please help me I can't find answers for these questions: here is the link for the article https://www.pbs.org/wgbh/nova/transcripts/2805cancer.html What type of substances are angiostatin and endostatin and where are they produced? What do they do? A) describe the experiments using cow bones to discover anti-angiogenic substances. Why was this used as a source of these potential proteins? B) describe the “accidental” discovery of a novel antiangiogenic substance because of lab contamination?
From a genetics point of view in simplified terms Breakdown Muscular Dystrophy 1.) Explain the specific genes involved 2.) Explain becker vs. duchenne dystrophies 3.) Explain treatments
What recent advancements in hematology research have shed light on the role of non-coding RNA molecules in regulating hematopoiesis and hematological disorders?
Describe the mutational event that produces the MYC oncogene in Burkitt’s lymphoma. Why does the particular mechanism for generating oncogenic MYC result in a lymphoma rather than another type of cancer? Describe another mechanism for generating oncogenic MYC.
What is the Philadelphia chromosome? Briefly describe how it causes chronic myeloid leukemia.
What is Rotor Syndrome Clinical Signs and Symptoms and Causes (Inherited or not)?
Angelica just learned that her paternal uncle, Aaron, passed away from hypertrophic cardiomyopathy (autosomal dominant). Angelica’s father was killed in a duty as a young man, and therefore, his status is unknown. Her two sisters, Eliza and Peggy, have been tested for the known causative mutation in the family and do not have it. What is the chance that Angelica has the familial mutation for HCM? Group of answer choices 1/33 1/10 1/21