Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine? Group of answer choices 5’-UACCUAGCU-3’ 5’-GUGCAAUUU-3’ 5’-AUGGUAACA-3’ 5’-GGUCGCCAU-3’
Q: What is the relation between GMO crops and the four of the principles of bioethics? What issues are…
A: A GMO, or genetically modified organism, whose genetic makeup has been modified using scientific…
Q: What is the role of Glycosyl transferase
A: Enzymes: are the biocatalyst that increases the rate of reaction without going change in itself. It…
Q: Assume a 5250 base pair, closed circular plasmid with 10 negative supercoils. (a) Calculate the…
A: The linking number is the sum of the twist number and writhe number. A number of several…
Q: OD OC in jo tas angeba pe angsod e si Sumago au jo zagoud jos bras angebau pur angesa e se mogos and…
A: Qualitative tests are performed to detect the presence of any substance through visible changes in…
Q: 1) Dilution fraction 2) Water
A: Dilution is a method to dilute the specific sample to achieve the required low concentration of the…
Q: An average protein will not be denatured by: a. a detergent such as sodium dodecyl sulfate. b.…
A: Protein denaturation disrupts the native structure of the protein i.e. proteins lose their…
Q: Treatment of a polypeptide with 2-mercaptoethanol yields two polypeptides 1.…
A: Given that treatment of a polypetide with 2 mercaptoethanol yielded 2 polypeptides: 1.…
Q: explain the results effect of temperature and pH on amylase activity Table 1 Effect of…
A: Amylase is the enzyme that can digest starch into simple monosacharides ( Glucose) or disaccharides…
Q: Which amino acid is predominantly used to add an NH2 moiety during the de novo biosynthesis of…
A: Denovo synthesis of Nucleotides referes to the process of Synthesis of nucleotides from simple…
Q: A biochemical reaction will proceed in the direction as written if: Group of answer choices H > 0. G…
A: The thermodynamical properties such as free energy change, enthalpy change, and entropy change…
Q: Which of the following amino acid residues would not provide a side chain for acid- base catalysis…
A: Introduction: Nearly one-third of all known enzymes require metal ions for the catalytic activity…
Q: How would IgG enhance innate immune system
A: Introduction: Immune system is a defense mechanism of body which protects us from any foreign body…
Q: Which of the following statements is true about brain metabolism in starvation? a) The brain can use…
A: A continuous supply of glucose and oxygen to neurons and astrocytes is required for brain…
Q: is amino acid 213 in 1mry is THR ?
A: 1MRY crystal structure represents the structure of the akt2 kinase domain. It belongs to a…
Q: 10 8 6 4 2 0 -2 -4 -6- -6 -4 -2 0 2 4 log [L] (nM) 6 8 10
A: Introduction: The interaction of proteins with proteins, small molecules, lipids, nucleic acids, and…
Q: What chemical group is found at the 5' end of a *?polynucleotide chain
A: Polynucleotide: The Linear polymer composed of- the many nucleotide units.
Q: Which ion concentration relationship is true when a neuron is at rest? (Select all that apply) More…
A: When a neuron is not sending a signal it is at 'rest'. During the rest state, all the voltage-gated…
Q: Statement Analysis: Statement 1: Mitochondrion is composed of membranes, the inner membrane and the…
A: Mitochondria is an important cell organelle which is called as power house of the cell as it is main…
Q: What will happen if the enzyme renin is mixed with 1N HCL before adding milk?
A: Rennin is a proteolytic enzyme or protein digesting enzyme also know as chymosin.
Q: A new virus has recently been discovered that infects human lymphocytes. The virus can be grown in…
A: Viruses are of two types based on their genetic material present inside their protein capsid. DNA…
Q: Which of the following is found inside a eukaryotic cell, but is absent in a prokaryotic cell? a)…
A: Introduction: All living organisms are classified into two broad categories as prokaryotes and…
Q: f the following statements is/are FALSE? aramagnetic metal ions can have an odd number of electrons.…
A: The crystal field theory is used for giving the description of the metal-ligand bond. The…
Q: What secondary structural elements are most likely present in this sequence? Please annotate the…
A: Proteins are polymers of amino acids linked by peptide/amide bonds between the carboxyl group of one…
Q: Cellular respiration connects the degradation of glucose to the formation of ATP, NADH and FADH2 in…
A: Cellular respiration is a complex process that occurs in three major steps which are Glycolysis…
Q: Statement Analysis: Statement 1: The first law of thermodynamics states that the amount of energy in…
A: We will discuss both the statements and check if they are true or false.
Q: A dehydration reaction will create (large or smaller) molecules by removing a molecule of (water or…
A: A molecule is a collection of atoms linked together by various types of bonds. A macromolecule is…
Q: Summarize what you have learned about different ways to change enzyme activity. complete a fishbone…
A: enzyme activity can be affected by various factors like temperature, PH, and concentration .enzymes…
Q: The site of entry and binding of the incoming activated amino acid. Group of answer choices A site…
A: During translation protein synthesis occurs from RNA. The sequence of nucleotides in RNA act as…
Q: The following has the lowest energy per gram when oxidized Carbohydrate protein ethanol O Lipids O
A: Introduction: Biomolecules are the macromolecules produced by the tissues of the organisms. They are…
Q: Which statement about lipids is incorrect? A) Fatty acids are found in membranes as triaglycerols,…
A: In nature, lipids are non-polar chemical compounds that dissolve in non-polar organic solvents but…
Q: The most common cause of death from tobacco smoking is: O emphysema O strokes heart disease O lung…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: There are various types of DNA-targeting drug, including DNA alkylating agents, DNA intercalators…
A: Cancer means uncontrolled cell division. There are several therapeutic agents are used to treat…
Q: The nucleic acid bases: a. absorb ultraviolet light maximally at 280 nm. b. are all about the same…
A: Nucleic acids are DNA and RNA are made up nitrogen bases as one of their components. Nitrogen bases…
Q: In RNA OH group is present at 2' position True O
A: Nucleic acid is made up of nucleotides, when number of nucleotides are joined together then the…
Q: Which of the following is the best description of the composition of a triglyceride? O1 glycerol + 2…
A: Triglycerides are used to store fatty acids in the adipose tissue of humans. Triglycerides can be…
Q: the chemistry behind the buffer system in blood.
A: In biological research, buffers are frequently used to keep the pH of particular processes constant.…
Q: Item: Statement: a) Active site b) Induced fit c) Enzymes d) Enzyme-substrate complex 1. Decreases…
A: Metabolic activity is constant in living things. All live cells are constantly undergoing thousands…
Q: METHOD: Touch different surfaces and then wash your hands and with your bare hands place another…
A: Introduction: Hand washing is the act of cleaning our hands with soap and water in order to remove…
Q: 6E. Draw a reaction coordinate diagram describing the different steps of ATP synthase catalysis,…
A: ATP synthase is localized in the inner mitochondrial membrane enzyme and catalyzes the synthesis of…
Q: Draw the structure of 1-linolenyl-2-arachidyl-3-phosphatidylserine
A: Phosphatidyl serine is a glycerophospholipid composed of fatty acids, phosphate group, serine, and a…
Q: An enzyme with a high turnover number has A. a high Kcat. B. a low Km. C. a high Vmax. D. a high…
A: Turnover number = Vmax/[ET] Vmax is maximum velocity of reaction ET is given enzyme concentration
Q: give the significance/role/effect of the reagent/condition in the isolation or analysis of a…
A: Deoxy ribonucleic acid (DNA) is the genetic material of the cell which carries the information on…
Q: give the significance/role/effect of the reagent/condition in the isolation or analysis of a…
A: The classical method of lipid extraction from egg yolk is the 2-Propanol/Hexane solvent extraction…
Q: Nitrogen-fixing bacteria reduce ammonia (ammonium ion) to nitrogen gas.
A: Rhizobium or azotobactor , are prokaryotic organisms are capeble of fixing molecular form of N2 in…
Q: Give a precise definition of the porphyrin ring, explain how it relates to ions and molecules, and…
A: Porphyrins are a class of heterocyclic macrocycle organic compounds made up of four modified pyrrole…
Q: Q/What are the Irreversible inhibitor ?
A: Inhibitor is an agent that slows or interferes with the chemical reaction. Enzyme inhibitor is a…
Q: Write notes on the following topics: 1- Structure and function for adipic acid and suberic acid 2-…
A: "Since you have posted a question with multiple subparts, we will solve first three subparts for…
Q: Which of the sugars in the following figure is/are D sugars? Choose all correct answers. CHO CHO CHO…
A: First question: D-configuration refers to any chemicals that can be linked to (+)-glyceraldehyde…
Q: Choose the FALSE statement about protein electrophoresis. The proteins in the gel can be…
A: Electrophoresis is a process in which electric field is applied to separate macromolecules like…
Q: A. Experimental Results Sample No. 1 2 3 4 5 *Enter qualitative observations Table 1. Results of the…
A: Sample No. 1- Lactose Sample No. 2- Fructose Sample No. 3- Starch Sample No. 4- Ribose Sample No. 5-…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letterA mRNA sequence is shown below. Note that the coding strand of DNA has the same sequence as the mRNA, except that there are U’s in the mRNA where there are T’s in the DNA. The first triplet of nucleotides AAU (underlined) is in frame for coding, and encodes Asparagine. 45 50 55 60 65 5’—A A C G A A U C G U C G C C A A C U A A G A G –-3’ Which of the following DNA mutations is almost certain to result in a shorter than normal protein? at position 56 a change from G to C an insertion of a G after the G at position 56 inversion of region 56-59 (G C C A) an delete the C at position 52 None of the above.
- The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter GlyWhat is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain? 5'-ATGTCGACAGCCTAA-3' First Second Letter Third Letter Letter phenylalanine phenylalanine serine tyrosine tyrosine cysteine cysteine U serine leucine serine stop stop A leucine serine stop tryptophan arginine G leucine proline histidine leucine proline histidine arginine leucine proline glutamine arginine arginine A leucine proline glutamine isoleucine threonine asparagine asparagine lysine serine isoleucine threonine serine A isoleucine threonine arginine methionine threonine lysine aspartate arginine valine alanine glycine glycine valine alanine aspartate C G valine alanine glutamate glycine glycine A valine alanine glutamate O Met-lle-Thr-Ala-STOP O Met-Ser-Trp-Arg-STOP O Met-Tyr-Thr-Arg-STOP O Met-Ser-Thr-Ala-STOP
- Table 8.2: Transcription and translation of the first 7 codons in the B-globin chain of hemoglobin. Normal Sequence Mutated Sequence DNA DNA amino acid DNA DNA amino Codon MRNA Codon MRNA coding template strand coding template strand strand acid code code strand sequence sequence G 1 1 G G C 2 A 2 A 3 G G A A 4 4 C G A G G G G 7 A 7 A G G Shape of RBC Shape of RBC 23 3.A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain? 5'-ATGTCGACAGCCTAA-3' First Second Letter Third Letter U A G Letter phenylalanine serine tyrosine cysteine U phenylalanine serine tyrosine cysteine U leucine serine stop stop A tryptophan arginine arginine leucine serine stop leucine proline histidine U leucine proline histidine leucine proline glutamine arginine A leucine proline glutamine arginine G isoleucine threonine asparagine serine U isoleucine threonine asparagine serine A isoleucine threonine lysine arginine A methionine threonine lysine arginine G valine alanine aspartate glycine U valine alanine aspartate glycine G valine alanine glutamate glycine A valine alanine glutamate glycine G O Met-lle-Thr-Ala-STOP O Met-Ser-Thr-Ala-STOP Met-Ser-Trp-Arg-STOP Met-Tyr-Thr-Arg-STOPFor each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid
- You may wish to consult the genetic code above to answer the following question. A mutation has changed a portion of a protein coding gene that encodes a messenger RNA sequence. The original messenger RNA sequence is 5'-AUGCCCAGAGCU-3' Which mutation is a frameshift mutation that changes all of the amino acids that follow the changed sequence? O 5-AUGCCCUGAGCU-3' 05-AUGCCCCAGAGCU-3" 05-AUGCCCACAGCU-3" 05 AUGCCCAGGGCC-3"If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- G5. Below is a segment of RNA, transcribed from a DNA sequence. Use the following codon chart to help answer the questions below. 5' AUG/CCU/ACG/GAC/UGG/CCU 3¹ First Letter U C A The genetic code Second Letter A U с G phenylalanine serine tyrosine cysteine phenylalanine serine tyrosine cysteine leucine serine stop G leucine leucine leucine leucine leucine serine proline isoleucine start/ stop histidine stop tryptophan arginine proline histidine arginine proline glutamine arginine proline glutamine arginine threonine asparagine serine isoleucine isoleucine threonine asparagine serine threonine lysine arginine threonine lysine arginine methionine valine valine valine valine a. What polypeptide would be generated by this sequence? alanine aspartate glycine alanine aspartate glycine alanine glutamate glycine alanine glutamate glycine Third Letter DUAGUUAGUUAG C с А UCAG b. The RNA is mutated to: 5' AUGCCCACGGACUGGCCU 3. What type of mutation has occurred? Show the new polypeptide chain. c.…