Q: The technique of tandem mass spectrometry is used to determinea. the amino acid sequence of a…
A: Spectrometry is the measurement of the interactions between light and matter, and the reactions and…
Q: The technique of DNA sequencing involves performing _______________ . A) northern blotting B)…
A: DNA sequence can be determined by performing DNA sequencing method in vitro.
Q: The function of a restriction enzyme is to a. prevent the movement of DNA outside the nucleus b.…
A: Restriction enzymes:- these are the proteins and mostly isolated from prokaryotes. These enzymes…
Q: The small circular pieces of DNA that can be transferred into bacteria are called
A: DNA is the hereditary material present in human beings and most other organisms. It is a molecule…
Q: If DNA of a particular species was analyzed and it was found that it contains 27 percent A, what…
A: The chemical building blocks of DNA is called nucleotides. These building blocks has three parts - a…
Q: Why was the cold ethanol added to the soap and salt mixture?
A: DNA - is Deoxy Ribo Nucleic acid is a hereditary material which contains all the genetic information…
Q: DNA gyrasea. promotes negative supercoiling.b. relaxes positive supercoils.c. cuts DNA strands as…
A: Deoxyribonucleic acid (DNA) replication is the biological process of producing two identical…
Q: Which of the following statements is accurate for DNA replication in your cells, but not PCR? a.…
A: BASIC INFORMATION ABOUT GENETIC MATERIAL DNA It stands for deoxyribo nucleic acid. It is the…
Q: The sequence below (A) was read from the autoradiogram (B). (A) 5'…
A: Note: since you have asked multiple unrelated questions, as per the honor code we are answering the…
Q: Electrophoresis separates fragments of DNA according to_____ . a. sequence b. length c. species
A: Deoxyribonucleic acid (DNA) is a genetic material and it carries genetic information from one cell…
Q: Shotgun sequencing is a method of DNA sequencing in whicha. the DNA fragments to be sequenced are…
A: Deoxyribonucleic acid (DNA) sequencing is the process of determining the nucleic acid sequence based…
Q: Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in: A) Recombinant…
A: VNTRs are repeated units that occur in the genome and display length variations. The VNTRs consist…
Q: DNA strands that can form a double helix are said to be Select an answer and submit. For keyboard…
A: Deoxyribose Nucleic Acid or DNA is a double-stranded molecule with the shape of a twisted ladder.
Q: Which of the following is not a part of the Sanger method tosequence DNA?a. dideoxynucleotides b.…
A: Sanger sequencing is additionally called Chain termination method. DNA sequencing is the process to…
Q: A.) Chemical changes to the DNA caused by mutations can cause hazardous damage to the DNA. B.)…
A: DNA: DNA is a polymer made up of two polynucleotide chains that coil around each other to form a…
Q: To make a new DNA strand, which of the following is necessary? a. A template strand c. Heavy…
A: The separating process of strands of the double helix would provide two templates for the synthesis…
Q: Bacteriophages are viruses that infect bacteria. Depending on the bacteriophage, their genome can be…
A:
Q: a mutation in dna that adds +1 ot -1 nucleotide or +2 or -2 nucleotides is called a______? (choose…
A: Given condition: a mutation in dna that adds +1 ot -1 nucleotide or +2 or -2 nucleotides. Mutation…
Q: What will happen to the concentration and the A260/280 ratio of the DNA sample in the following…
A: Biotechnology is the use of our understanding of biological processes to develop useful applications…
Q: helicase
A: The unwinding of DNA is a complex process. It is done during the DNA replication. It is done when…
Q: Define the following terms: a. DNA typing b. short tandem repeats c. DNA profile d. nucleosome e.…
A: a. DNA typing: DNA typing can be defined as the procedure in which variations in the DNA strand is…
Q: Illustrate the central dogma of life showing: a) codons b) Complementary strand of the master DNA c)…
A: The central dogma is the illustration in which DNA is converted into RNA and then into proteins.
Q: Which of the following characteristics is not true of a plasmid?a. It is a circular piece of DNA.b.…
A: Deoxyribonucleic acid (DNA) is a long molecule. Deoxyribonucleic acid is composed of two…
Q: he purpose of using a washing soap in DNA extraction experiment is to D a. Cut the proteins away…
A: DNA stands for deoxyribonucleic acid. It is present in the nucleus of the cell It stores genetic…
Q: Choose the combination of answers that most accurately completes the statement.Which of the…
A: For a living organism, the cell is considered the basic fundamental unit of life. Organisms can be…
Q: When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain…
A: Frederick Griffith was responsible for conducting an experiment using Streptococcus pneumoniae,…
Q: All are true about PCR except A. Automated PCR machine called a thermal cycler B. A thermostable…
A: PCR stands for Polymerase Chain Reaction. PCR is a technique used to amplify DNA sequences and…
Q: DNA fingerprinting analyzes the DNA from individuals on the basis of the occurrence of in their…
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: ake this strand of DNA and a) Transcribe it, then b) Translate it. TAC GCA GTA ACA GGC CCT ATC a)…
A:
Q: Arrange the following steps in the sequence they would happen in a DNA cloning experiment. a.…
A: DNA is an important biomolecule present in the cell as it is responsible for various traits…
Q: A contig is a. a set of molecular markers used in gene mapping. b. a set of overlapping fragments…
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: In DNA technology, the term vector can refer to(A) the enzyme that cuts DNA into…
A: Plasmids are circular, double stranded unit of DNA, which replicates independently of the…
Q: A.) There is no change in the DNA sequence if nucleotides are added or removed, it will have no…
A: D. Both A and B are incorrect. There is no change in the DNA sequence if nucleotides are added or…
Q: Place the following stages of a physical mapping study in theirmost logical order:A. Clone large…
A: Artificial chromosome- laboratory constructed cloning vectors that carry larger DNA insert than…
Q: Which of the following is true of reverse transcriptase?a. It is required for the movement of DNA…
A: The enzyme engaged in reverse transcription is reverse transcriptase. The enzyme works through using…
Q: A.) Damaged DNA can be reversed if nucleotides can be replaced with a proper nucleotide for a…
A: DNA repair : The DNA molecule may undergo some alternations due to various factors like exposure to…
Q: A protein that can cut DNA at specific DNA base sequences is called a a. DNase. c. restriction…
A: A cell is that the most fundamental unit of life. Each organism's genetic material is contained in…
Q: Define the following terms: a. molecular biology b. genetics c. replication d. transcription e.…
A: The Central Dogma is the process of converting the genetic molecule into functional products where…
Q: In the "DNA Extraction from Fruit" laboratory, DNA from a banana, kiwi or strawberry was extracted.…
A: DNA Or deoxyribonucleic acid is the common biomolecule present in living things, that is responsible…
Q: When a dideoxyribonucleotide is incorporated into a growingDNA strand,a. the strand elongates…
A: Given: Explain when a dideoxyribonucleotide is incorporated into a growing DNA strand, choose the…
Q: Identify the false statements. There may be more than one correct answer. A) The binding of DNA to a…
A: Genomic DNA and plasmid DNA are isolated using silica resin columns than using traditional…
Q: A. Changes and damages to the DNA is permanent and has no remedy. B. Damage to the DNA can be…
A: DNA or Deoxyribonucleic acid, is the hereditary material that composed of two polynucleotide chain…
Q: In gel electrophoresis, DNA is made visible with Use the following information to answer the next…
A: Introduction The technique of gel electrophoresis is used to separate DNA fragments based on their…
Q: For each example: a. fill in the complimentary DNA strand b. fill in the correct mRNA bases by…
A: Genetic code is the information stored in DNA in the form of its nucleotide sequence.
Q: Identify the false statements. There may be more than one correct answer. A) The binding of DNA to a…
A: High quality DNA means that A260/A280 ratio is between 1.8 to 2 whereas a ratio closer to 1.8 is…
Which of the following is not a DNA sequence?
a. TAG
b. AUGAUUCT
d. AAAAAAAAAA
e. CGG
Step by step
Solved in 2 steps
- Cystic Fibrosis is caused by which of the following? a. Replacement of three nucleotides with a new three nucleotide sequence b. Addition of three nucleotides c. Deletion of three nucleotidesA gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg-tyr. A mutation in this gene removes the first G in the strand.What is true of this mutation's effect on the phenotype?1.It will affect the phenotype because although most of the protein will be identical, the first amino acid will be different.2.It will not affect the phenotype because the protein will be identical to the original protein.3.It will affect the phenotype because all the amino acids past this point will be different from the original protein.4.It will not affect the phenotype because only the first amino acid is different from the original protein.One half of a DNA strand has the following sequence of bases GCTACGGCGTTATCCCC. What would appear on the other half? A. CGATTCCGCAATAGGGG B. GCTAAGGCGTTATCCCC C. CGATGCCGCAATAGGGG D. ATAGGAATACCGCTTTT E. TATCCTTATGGCGAAAA
- If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. ATATATATCGCGTTAAATTCTA O b. GCGCGCGCGCGCGCGCGCGCG O c. AAAAAATTTTTCCCCCGGGGG O d. TACTACACTGTGGTTAATTAAA O e. GGGGGCCCCCAATTCCCCCCC tune of proteins that heln in regulating the levels of different molecules in human body, e.gif the DNA sequence if: TTACGTA, the complementary RNA sequence will be following A. AATCGAT B. AATGCTA C.AATGCAT D.AAUGCAUA segment of DNA has the sequence ATGCCT. What will be the sequence for the transcripted segment? O UACGGA O ATGCCT O TACGGA O AUGCCU
- Which of the following sequences on a DNA moleculewould be complementary to GCTTATAT?a. TAGGCGCGb. ATCCGCGCc. CGAATATAd. TGCCTCTCIf you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. ATATATATCGCGTTAAATTCTA O b. AAAAAATTTTTCCCCCGGGGG O c. GGGGGCCCCCAATTCCCCCCC O d. TACТАСАСTGTGGTTААТТААA O e. GCGCGCGCGCGCGCGCGCGCG ype here to search ChpA DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA fragments? a. AGTCCGAAGTC c. GACTTCGGACT b. TCAGGCTTCAG d. UGAGGCUUGAG
- Approximately what percentage of DNA is noncoding? a 98% b 2% c 50% d 25%Given several unknown solutions, you are asked to use your knowledge of nutrient tests to identify the unknown substances in the vials. The substances used to create the unknowns are: galactose, olive oil, egg white (albumin), and starch.Each unknown vial contains one or more of these substances. The results of the tests are below. What substances are found in UNKNOWN #2? * Unknown #1 Unknown #2 turns blue after turns blue after Benedict's heating in a water Reagent bath heating in a water bath Sudan IV turns bright red Indicator upon addition turns pale pink upon addition turns brown upon turns black upon Lugol's Solution addition addition turns blue upon addition turns purple upon Biuret addition Reagent Your answerChoose the combination of answers that most accurately completes the statement.The function of ligase is to a. rejoin segments of DNA c. synthesize cDNA b. make longitudinal cuts in DNA d. break down ligaments