Which of the following is a transition mutation? OG --> T G --> A G --> C
Q: 9. L-lactate dehydrogenase: L-lactic acid:: Salivary a-amylase: a) D-aminoacid b) L-aminoacid c) a-…
A: All biological chemical reaction reactions in living beings are controlled by enzymes. If enzymes…
Q: In the RBCs of the patient in the picture, which of the following would be expected? Explain. A.…
A: Red blood cells (RBCs) are the blood cells, which help to carry oxygen from the lungs to the tissues…
Q: The laboratory requests of the physician are Glycosylated Hemoglobin and Serum Glucose for Mr. John…
A: Introduction: Glycosylated hemoglobin is a form of hemoglobin that is measured primarily to monitor…
Q: An individual developed a condition characterized by progressive muscular weakness and aching muscle…
A: This shuttle functions in the transporting the fatty acids present in the cytosol to the…
Q: An Autosomal Dominant trait is only evident in the homozygous state. True False
A: A Dominant inheritance occurs when an abnormal gene from one parent is capable of causing disease.
Q: Why is it difficult to accurately estimate Km and Vmax values from a Michaelis-Menten plot?…
A: Introduction: The study of reaction rates and how they change in response to changes in the…
Q: 1. Some receptors have more than one ligand binding site. This situation can be modeled as shown…
A: Consider the condition given below where 2 species 'A' and 'B' come together (association) to form…
Q: importance of nutrition
A: Nutrition is the biochemical process by which an organism eats a healthy and balanced diet through…
Q: What is the possible drug interaction in the following structure of phenoxybenamine?
A: Phenoxybenamine is a haloalkylamine drug which is used to treat hypertension. Haloalkylamines does…
Q: What is the difference between the two salt precipitation methods: salting in and salting out?…
A: The solubility of a protein in solution depends on the concentration of the salt present in…
Q: What Type of guard column, separation column, and suppressor used for anion- exchange chromatography
A: In the anion-exchange chromatography, the process of separation occurs which is based on the charges…
Q: Assume you were given a mixture consisting of one molecule each of all possible sequences of a…
A: Proteins are long chains of single amino acids. The human body uses 20 different amino acids in…
Q: Explain the meaning of metabolic interconversion
A: Metabolism is the body's cells is used for changing the food into energy. The human bodies need this…
Q: 6. An organic substance bound to an enzyme and essential for its cavity is called: a. coenzyme b.…
A: Enzymes are proteins that involved in metabolic function by speeding up the chemical reaction.
Q: Calculate the number of phosphates, deoxyribose and ribose, and nitrogenous bases needed for a:…
A: Nucleic acid can be of 2 types: DNA (deoxyribonucleic acid) RNA (ribonucleic acid) DNA carries…
Q: Basing off of the structures of monosaccharides, explain how a simple sugar can nucleophile. You may…
A: Electrophiles are electron deficient groups. Nucleophiles are electron rich groups.
Q: Which of the following viruses have been used as vectors for gene delivery?
A: Gene delivery is a process of introducing the foreign genetic materials which are DNA and RNA into…
Q: Identify if the following is a pyrimidine/purine nucleotide or a pyrimidine/purine nucleoside and…
A: The structure of pyrimidine/ purine nucleoside or pyrimidine/ purine nucleotide with ribose or…
Q: Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation?…
A: Steps in Prokaryotic Translation Initiation: GTP bond Initiation factors (IF1-3) binds to 30S…
Q: Consider an enzyme (P) that gets activated by forming a dimer (P2): 2P P2 At 25 °C, we have AH- 19…
A: ∆Ho is change in enthalpy of the protein activation= 19KJ/mol, it is the heat content of the given…
Q: For carbohydrates to be converted to energy, it undergoes the process of metabolism, where in the…
A: Carbohydrates are major energy source of human beings. It is most important component of our diet .…
Q: 1. List several methods (other than Bleeding Time -Ivy method, Capillary Tube Method, Lee and White…
A: Introduction: Bleeding time: It is the time interval between the skin puncture and spontaneous,…
Q: How are the organelles in a cell similar to the organs in a human body? Explain in 3-5 sentences.
A: Organelles are cellular components, which perform specific functions inside the cell. Different…
Q: Feedback See Periodic Table Which of the following correctly describe both a lectin and a…
A: Lectins are stated as either the proteins or the glycoproteins that are present in almost all…
Q: Which polymerase transcribes genes with internal control regions (ICR)? O RNA Pol I RNA Pol III RNA…
A: The eukaryotic cells have three distinct RNA polymerases that transcribe different sets of genes.
Q: do aklaloids minic neutrotransmitters in our bidy? amines contain: a) nitrogen atom b) an acid c)…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: (Q39) A mutation in a certain protein results in the presence of a cysteine residue (rather than the…
A: A mutation is considered as a change in a DNA sequence. Mutations can easily result from specific…
Q: How does NanoDrop quantify DNA?
A: Quantitative analysis techniques are used to measure the quantity of a substance in a solution.…
Q: 3. (а) 0.0050 M operate at one-quarter of its maximum rate? At what substrate concentration would an…
A: To study an enzyme kinetics, Michaelis-Menten kinetics equation is best known mathematical…
Q: When using blunt-end primers, how would you determine the correct plasmid construct from the…
A: Ligation is the joining or ligation of two nucleic acid fragments through the action of a ligase…
Q: chemicals being applied for the leafy vegetables to produce seeds? If yes,
A: In today's world , almost all grown vegetables are being sprayed with pesticides, fungicides and…
Q: Reactions and Thermodynamics of Glycolysis
A: Third step of glycolysis, fructose-6-phosphate is converted to fructose- 1,6-bisphosphate by…
Q: 6. When a concentrated alkali solution acts on the purine cycle, it breaks down? A. Ester group B.…
A: Purines are nitrogenous bases composed of two rings, which are fused together. Adenine and guanine…
Q: 4. Read the absorbance at 595nm of the blank and test solutions. Calculate the protein concentration…
A: Bradford method of protein assay: This is a method used for determination of concentration of…
Q: Two dimensional electrophoresis separates proteins according to their isoelectric focusing and mass.…
A: Two dimensional electrophoresis:- powerful electrophoretic method for separation and analysis of…
Q: A solution has a pH of 5.4. What is its pOH O5.4 8.6
A: The hydrogen ion concentration [H+] and hydroxide concentration [OH–] in a aqueous solution have an…
Q: Consider the Michaelis-Menten equation, below: Vmar S V. k + [S] %3D What is the relationship…
A: [S] : Substrate concentration V= Vmax[S]/(Km+[S]) Vmax: Maximum velocity Km: [S] at which V is…
Q: Identify Four (4) possibilities in cell culture practices that able affect the quality and yield of…
A: Cell culture It is a method of growing the cells in artificial condition i.e. cells are grown…
Q: Which peptide will yield the following qualitative resul Millon's Test (+) Fohl's Test (+) Sakaguchi…
A: Introduction: Amino acids are the building block of proteins and are linked to a peptide bond. Each…
Q: Genetically modified cotton plants produce the toxin encoded from the gene originated from the…
A: Any organism whose genetic material has been altered using genetic engineering techniques is…
Q: O The unknown sample contains tyrosine and tryptophan residues O The unknown sample only contains…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…
Q: Determine the number of carbon atoms present and the the total number of phosphate groups present in…
A: In our body, many metabolic pathways occur. In these pathways, Glycolysis also occurs to convert…
Q: . ) In one (1) sentence point out a key structural similarity and difference in each of the…
A: Nucleic acids are constituted of nucleotides linked via phosphodiester linkages while proteins are…
Q: What type of control generally involves binding of a repressor protein to a regulatory DNA sequence?…
A: Repressor : DNA binding protein which inhibits the expression of 1 or more genes via the binding to…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: 2. Which of the following is not a type of specificity?
A: If we talk about specificity there is many feilds where the specificity is play there role and all…
Q: In the RBCs of the patient described above, which of the following would be expected? And give the…
A: Pyruvate kinase enzyme deficiency typically can manifest clinical symptoms on red blood cells…
Q: Yeast fermentation is of a value in making baked products due to the release of: Select one: O a.…
A: Fermentation occurs in the yeast in anaerobic conditions. Alcoholic fermentation occurs in the…
Q: topic: sds-page gel If APS is not available, what other chemicals can be used alternatively to…
A: APS stands for Ammonium Persulfate. It is an oxidizing agent that is used along with TEMED in order…
Q: Prepare a concept map connecting carbohydrate and lipid synthesis. Your map should include shared…
A: Carbohydrate metabolism : Carbohydrates are the most abundant molecule defined as a poly hydroxy…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 3 images
- Describe the mutation that occurs in the following examples (be specific, if possible): BOAT to BAT SOAP to SOUP PAY to PLAY GCTCT to GCACT TGCCC to TACCC CATGC to GATGC TATATA to TACATAWhich of the following is a transition mutation? OC --> G O C --> T OC--> AWhich of the following is a transversion mutation Select 4 correct answer(s) A --> T C --> T C --> G A --> G A --> C G --> T
- A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertionA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-GlyA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. MMutant 4: Met-Ser-Pro-Glu-Gl
- A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 2: Met-Ser-ProA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-GlyA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. For each mutant, indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly b. Mutant 2: Met-Ser-Pro c. Mutant 3: Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys d. Mutant 4: Met-Ser-Pro-Glu-Gly e. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Gly
- The genetic alteration responsible for sickle-cell anemia in humans involves: a transition mutation from A to G, substituting glutamic acid for valine in a-globin a transversion mutation from T to A, substituting valine for glutamic acid in b-globin a transition mutation from T to C, substituting valine for glutamic acid in b-globin a transversion mutation from G to C, substituting glutamic acid for valine in a-globin a frameshift mutation of one ATC codon, removing glutamic acid from b-globinThe table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as well as the type of single nucleotide mutation that produced each mutant polypeptide. Peptide sequence Met - Leu - Arg - Ile - ... Type of mutation Wild type Met - Leu - Arg - Met - ... Met - Leu - [STOP] Mutant 1 transition Mutant 2 transversion Mutant 3 Met - Phe - Arg - Ile - ... transition Determine the mRNA sequence for the wild type polypeptide by identifying the codons that correspond to each amino acid. The first codon has been filled in for you. Codon information can be found in the codon access table. Met Leu Arg Ile Answer Bank CỦA AUA CGU CGA AUG AUC AGA UUG CÚCThe following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing