Q: What part of the genome is used for a genetic fingerprint? A Introns Ministe OC. Chromosomes OD…
A: DNA fingerprinting is a technique that shows the genetic makeup of living things.
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? I and…
A: In the 1950s, Erwin Chargaff, a biochemist, discovered that the nitrogenous bases (A, T, C, and G)…
Q: Sticky ends are single stranded DNA overhangs that: O stabilize DNA from nucleases O form primers…
A: DNA ligases join DNA molecules together by synthesizing phosphodiester bonds between nucleotides…
Q: When DNA copies itself..the first step that DNA must do is: O DNA Polymerase checks for errors after…
A: The synthesis of new DNA molecule from the old DNA is known as the replication process. The…
Q: Draw a stretch of DNA that would code for the amino acid "lysine". Be sure you draw all the…
A: The given structure is shown below.
Q: Suppose there are three tubes containing following samples in the laboratory. The three tubes are…
A: DNA(deoxyribonucleic acid) is defined as the building block of life because it carries all the…
Q: DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC…
A: DNA is a hereditary material that is made up of adenine Guanine Cytosine and Thymine. As it is a…
Q: Normal Strand: DNA: GCA ATG CAC MRNA: Amino Acids:
A: A frameshift mutation is a genetic mutation. It is caused by indels of the number of nucleotides in…
Q: 1. T DNA strand NUCLEUS MRNA CU CYTOPLASM 6. 5. Lysine 7. AAGUUU UGUUCA AA 4. 2.
A: CENTRAL DOGMA- Replication is the process when DNA replicates itself means it will make copies of…
Q: It is a permanent change in the DNA sequence that makes up a gene. Mutations range in size from one…
A: Mutation is any certain change in chromosome or gene of a species and this change can transfer from…
Q: Okazaki fragments O are short DNA fragments are intermediates in DNA replication begin with a short…
A: Okazaki fragments are a short sequence of DNA nucleotides. The answer is given in step 2.
Q: Give the COMPLIMENTARY DNA strand. 3'TAC TAC TTT AMA TCA CTC TCC GCT GGT GTG AGT TGC CCT ACT 5
A: Deoxyribonucleic acid or DNA is a biomolecule composed of two polynucleotide chains that coil around…
Q: Short DNA sequence having single occurrence in genome isa) Expressed sequence tagb) Sequence tagged…
A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…
Q: What is the name of the enzyme, shown as the yellow blob circled in red, that opens the helix and…
A: The replication is a process by which new DNA is produced from the old DNA. In the S-phase of cell…
Q: Refers to the two strands of DNA double helix. Please choose one answer only. A. Nicks B. Templates…
A: Introduction: As it relates to genomics, the phrase "double helix" is used to define the actual…
Q: 6.c. Mutated DNA Template Strand #3: 3’-T A C T G A C T G A C T A T C-5’ Complementary DNA sequence:…
A: Mutation is the change in the nucleotide sequence in DNA or RNA that causes a change in the…
Q: A segment of DNA from theinterior of a single strand is shown inFigure Q4–1. What is the polarity of…
A: DNA, is a nucleic acid it is deoxyribonucleotide, it is called deoxy because the 2 carbon position…
Q: In a double-stranded DNA molecule, how are the sequences of each strand related to each other? The…
A: Deoxyribonucleic acid, also abbreviated as DNA, it is the principal informational macromolecule of…
Q: Whatis the purpose of the dideoxynucleotides in DNA sequencing? OCH2 base - OCH2 base H. H. H. H. H.…
A: ddNTP(dideoxynucleotide triphosphate) used in sanger dna sequencing .which terminate the…
Q: Which of the following double stranded DNA molecules would require the most amount of energy to…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Here's a line of DNA code: TACACGCCAGAG Transcribe it: (USE caps, no spaces)
A: The process of transcription in which RNA is synthesized from the DNA strand is carried out by the…
Q: What is happening at letter "C"? O RNA Primase is laying down some RNA Primer on the lagging strand…
A: DNA replication is a process by which one parent DNA replicates to form two identical daughter DNA.…
Q: he purpose of using a washing soap in DNA extraction experiment is to D a. Cut the proteins away…
A: DNA stands for deoxyribonucleic acid. It is present in the nucleus of the cell It stores genetic…
Q: Split DNA (old strand) Split DNA (old strand) T New DNA New DNA strand strand A T A А A C C G A T A…
A: There are five nucleic bases—adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U),…
Q: The enzyme which has a final mistake rate of 1 mistake / 10° nucleotides is enzyme which has a final…
A: Deoxyribonucleic acid (DNA) replication is a biological process in which two identical replicas of…
Q: Here is a strand of DNA: 5'-ATCCCGAATTAT-3' give the complementary strand of RNA making sure its…
A: DNA unlike RNA is a double-stranded molecule. In molecular biology, the genetic information in DNA…
Q: Sticky ends are 1. DNA fragment with single - stranded ends 2. produced by the action of DNA…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: You have this sequence of DNA from leading strand: GGCATGCGA From this you know: * O G is the 5'end…
A: DNA acts as genetic material in all living organisms. During replication of DNA, at each replication…
Q: What does it mean that one end of a DNA strand is the 5' end? O This end has been primed 5 times.…
A: DNA is what is inside the nucleus of mostly all cells. It carries the genetic information which is…
Q: DNA polymerase separates the two strands of the relaxed DNA helix; the point of separation is the…
A: a. DNA replication is the biological process of producing two similar copies of DNA from one…
Q: Which of (a)-(d) is complementary to the DNA segment 5'-ATGAGCCAT-3'? * O 5'-TACTCCGTA-3' O…
A: Deoxyribonucleic acid: The replication of DNA involves the production of new molecules that have a…
Q: 4) Repetitive DNA comprises about _________ of chromosomal DNA A) 5% B) 40% C) 60% D) 95%
A: DNA is the genetic material in most living organisms. It carries information for synthesis of all…
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-AGCCTCG–3'…
A: When the structures of molecules or macromolecules match together in such a way that physical,…
Q: which of the follocoing waeleng ths ranges is use d to measue absorbence of DNAĄ 10 0 - 2oonm 200…
A: Deoxyribonucleic acid(DNA) is one of the most important biochemical compounds for living cells. It…
Q: The DNA molecule is replicating. Below are four DNA fragments. DNA Fragments: 1. CGATCT 2. TCACGA 3.…
A: The Nucleotide polymers that are responsible for determining and regulating the genetic…
Q: Which of the following things must happen first if DNA is going to be replicated * O DNA gets broken…
A: DNA replication is the process which is responsible for producing the daughter ds DNA molecule from…
Q: What enzyme replaces the RNA primers on the Okazaki fragments on the lagging strand? DNA Pol II
A: DNA replication is the process by which DNA duplicates itself. One of the most important feature of…
Q: G. Aureliano has a mutation in the blue-shaded nucleotide in the TEMPLATE DNA sequence. Instead of a…
A: Introduction :- A mutation is a change in our DNA sequence that happens as a result of errors in DNA…
Q: 6.b. Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’ Complementary DNA…
A: In this question, we are given with a sequence of DNA which has a mutation. Given DNA sequence is…
Q: Which kind of chemical damage is depicted in this picture: IN H,N NH3 SARA NH DNA DNA Selar Base…
A: Base deletion is a type of mutation in which a base is deleted from DNA. Strand breakage is a…
Q: 1 Two DNA double helices are formed, showing semi- conservative replication (show what this means).…
A: Deoxyribonucleotide (DNA) is a molecule that carries genetic material in all living organisms. It…
Q: DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' is % of guanine in DNA fragment A is the 4th…
A: As per our company guidelines, we are supposed to answer only first 3 sub-parts. Kindly repost the…
Q: Transcription is the process by which a complementary mRNA strand is produced from one of the DNA…
A: Ans:- Complementory mRNA strand is G-A-U-G-C-U-U-G-A-C-U-G-C
Q: Which enzyme is used by the bottom daughter strand but not by the top daughter strand? O RNA primase…
A: dna replication is the process by which parent dna makes two daughter strands . the given diagram is…
Q: The technique of gel electrophoresis gives scientists an effective way to see some differences…
A: DNA stands for deoxyribonucleic acid. It is a double helix made up of two polynucleotide chains that…
Q: In regards to satellite DNA, the major difference between a LINE sequence and a SINE sequence is the…
A: In molecular biology, there are two types of genes ,coding and noncoding. Coding genes helps in the…
Q: A DNA molecule 300 bp long has 20 complete rotations. This DNA molecule is a. positively…
A: If DNA is in the form of a circular molecule, or if the ends are rigidly held so that it forms a…
Q: Why do most replication errors occur? O 1. DNA polymerases work very fast and mistakes are…
A: Deoxyribonucleic acid (DNA) is a protein molecule made up of two polynucleotide chains that wrap…
Q: 2. Öriginal DNA: TACGTTTCCCCT MRNA: amino acids: Mutated DNA:TACGTTTGC C C C T MRNA: amino acids:…
A: Transcription is the synthesis of m RNA from DNA. The translation is the synthesis of protein from m…
Step by step
Solved in 2 steps
- Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTTENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCEWrite down the DNA strand which is complementary to the strand shown below. Be sure to mark the ends of your strand appropriately. 5'ATGGCTTTA3'
- Give the DNA compliment to the following DNA strand. GTA SMH UUU GUA CATCreate the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-GGCAACGGTCCAGTCCAAGTTACG-3’The image shows a replication fork with template DNA strands, new DNA strands, and some replication proteins. Label the mage by moving the terms or descriptive phrases to the appropriate targets. lagging strand (or Okazaki fragment) Answer Bank protein that synthesizes RNA primer DnaB helicase DNA gyrase (topoisomerase)
- Create the complementary DNA strand: ACC-GCC-TAG-GCA Your answerThe X's correspond to the missing information. You need to determine what those X's represent DNA STRAND: XXX-CCC-GGG-GCG-XXX-XXX-XXX-GCC-ATA-TTA-XXX RNA STRAND: XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX PROTEIN: Met - X - X-X - Thr - Val - Glu-X-X-X - Trp To be clear, your answer is just the 3 sequences above without the X's (the highlighted yellow parts). There may be more than 1 correct answer for some parts of this assignment. Any answer your choose is fine. If you are unclear on how there could be more than 1 correct answer, review the lecture related to protein translation. Provide me with the: 1. Complete DNA sequence of 33 nucleotides 2. Complete RNA sequence of 33 nucleotides 3. 11 amino acidsYou have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTATGTGTAACTTGTCAT 5’