What is the viewing field diameter when you use 10X magnification on the dissecting microscope

Q: A mutation in a gene often results in a reduction of the product of that gene. The term for this…

A: Introduction  A mutation is a permanent alteration in the DNA sequence that makes up a gene.…

Q: Describe the interactions between the following water parameters: • Ammonia • Nitrite • Nitrate •…

A: Water has its own color, taste and constituents. Water suitability for different purposes is…

Q: QUESTION 3 The Cori cycle represents a metabolic link between glycolysis and gluconeogenesis. O True…

A: Introduction  Glycolysis is a metabolic pathway that takes place in the cytoplasm of cells and…

Q: Haemoglobin... A. Consists of one or more globin proteins, each with a copper-containing heme group…

A: Hemoglobin is a protein found in red blood cells that is responsible for transporting oxygen from…

Q: 11. Below are three different molecules that can be classified by their functional groups and…

A: Biological macromolecule are the substances that are required in enough amount for the body.…

Q: Genomic anticipation refers to observations that a genetic disorder occurs at an earlier age in…

A: The study of an organism's entire genetic makeup, including the DNA's sequence, structure, and…

Q: Explain the anatomical concepts associated with skeletal muscles and joints. Summarize this module’s…

A: Muscle is a type of soft tissue found in the body that is specialized for contracting and relaxing…

Q: How has the placement of the organs changed when comparing the pig to the shark?

A: The placement of organs in pigs and sharks differs because they have evolved to meet the specific…

Q: Which of the following cells have memory or produce memory cells? B Lymphocytes Basophils Dendritic…

A: Memory cells are a type of immune cell that are generated after an initial exposure to a pathogen,…

Q: Ch 5 – Biomolecules What are monosaccharides, disaccharides and polysaccharides? Give examples of…

A: Carbohydrates are classified into three main types: monosaccharides (simple sugars), disaccharides…

Q: C a b. d e f h

A: Introduction: The foundation of the nervous system are neurons. They communicate with various body…

Q: What is the application of DNA extraction in healthcare? Cite at least 3 specific examples.

A: Introduction : The act of extracting anything from a mixture is called extraction. To gain access…

Q: "Gain of function" mutations are generally dominant because one copy in a diploid organism is…

A: Gain of Function: It is a type of mutation in which the altered gene product has a new molecular…

Q: Epilepsy is a central nervous system (neurological) disorder in which brain activity becomes…

A: Epilepsy is a neurological disorder that usually affects the human central nervous system and is…

Q: Which statement about the structure of proteins is correct? a) The a-helix and ß-sheet are two…

A: Proteins are complex biomolecules that are essential to the functioning of living organisms. They…

Q: When hydrogen covalently bonds to carbon it creates a nonpolar bond. However, when hydrogen…

A: Hydrogen bonds form between a hydrogen atom that is covalently bonded to an electronegative atom…

Q: A nucleotide consists of a sugar-lipid-nitrogenous base. True False

A: Introduction :  Polynucleotides, like DNA and RNA, are chains of monomers containing various…

Q: Please help me answer and explain these questions: 1. Humans also express serum albumin. How do the…

A: 1&2) The molar extinction coefficient and molecular mass of proteins can be used to quantify and…

Q: Predict how mutations in the gene that encodes the spike protein might affect the types of cells the…

A: Introduction :- The spike protein is a component of many different types of viruses, including…

Q: The skull pictured here represents the species: A. Pongo pygmaeus B. Paranthropus boisei C. Homo…

A: Introduction  A skull is a bony structure that encases and protects the brain, as well as providing…

Q: Describe the main parts of a virus. Why are viruses called parasites? Describe the lytic cycle of a…

A: A virus is an infectious submicroscopic organism that only reproduces inside of living cells. All…

Q: one too few females one too many somatic cells infertility the germ line less sex chromosomes males…

A: Introduction : Aneuploidy refers to a condition in which an individual has an abnormal number of…

Q: What are the key features of biological measurements that biologists must consider when quantifying…

A: Introduction  Biological measurements refer to the quantification of various biological processes,…

Q: GGCACCTGCGATGCATGAATATATCGATCGGGAATCGCTATGTCAAGCCATGGCTAGATTA…

A: m RNA sequence is created by the enzyme called RNA polymerase that copies the nucleotides according…

Q: Define the words “Emerging Virus” and “Pandemic”. Give examples of human diseases caused by viruses.…

A: Virus:  A virus is an infectious submicroscopic creature that only reproduces inside of live cells.…

Q: What will you move/change to go from brightfield to phase contrast?

A: Phase contrast microscopy is a technique used to visualise transparent or translucent biological…

Q: A. What mutant phenotype are you using in this cross? B. If the mutant allele in this cross is a…

A: Genes are the hereditary structures responsible for controlling specific functions, they can exist…

Q: 1 A) . If green is dominant wt (Y) and yellow is a recessive mutant condition (y), depict a Yy…

A: Introduction :  A square diagram known as the Punnett square is used to predict the genotypes of a…

Q: With both incomplete dominance and codominance, one expects heterozygous and homozygous classes to…

A: Incomplete dominance and codominance are two modes of inheritance in which the phenotype of an…

Q: The inherited component of a phenotype is determined by the:     age of the organism…

A: Phenotype simply means a distinguishable characteristic.  Pheno, which has the same root as the…

Q: Explain how evolution of organisms/ populations occurs as a step by step process (use bullet points…

A: Evolution is a process in which populations of organisms change over time as a result of genetic…

Q: Cholesterol is an example of what type of lipid?

A: Option B: Steroid

Q: what is the calculated change over time from slope? and what condition changed the fastest?

A: For this question change over time can be calculated from the slope. For light the slope is 0.0199…

Q: n mice, the Ay allele of the agouti gene is recessive lethal, but it is dominant to wild type for…

A: Introduction  In genetics, dominance and recessiveness refer to the relationship between two or more…

Q: What kind of exudates do you expect to find in the soil?   What does phytoremediation mean in this…

A: There are two major types of riot exudates found in soil. [1] Low molecular weight compound (LMWC)…

Q: 6. A population has a homozygous recessive genotype (aa) of 36%. Calculate the following (show your…

A: Introduction The Hardy-Weinberg equilibrium states that the gene frequencies in a population will…

Q: Which of the following correctly compares cultural evolution and biological evolution? Cultural…

A: Evolution is a process that depends on natural selection and involves changes in a species' features…

Q: When introducing solid foods, infants experience food allergies that eventually weaken over time…

A: From birth until age one, infants are regarded as children. Any kid between the ages of birth and…

Q: The diagram shows which level of structure of a protein? hydrogen- bond HO-C HO ,0 CH₂ ionic bond-…

A: Proteins are complex macromolecules that perform a wide range of functions in living organisms. The…

Q: A triglyceride is made of glycerol attached to one fatty acid. True False

A: Long aliphatic chains that might be saturated or unsaturated make up fatty acids.

Q: Water-breathing aquatic endotherms are very rare because of... A. The low solubility of O₂ in water…

A: Introduction :- Endotherms are animals that generate their own internal heat to regulate their body…

Q: In a digestibility trial, a sheep consuming 0.85kg of hay DM containing 100g N/kg, gains 0.25 kg per…

A: The above set of questions are related to a digestibility trial conducted on a sheep. A…

Q: One characteristic of enzyme competitive inhibition is that it results in an increase in the Km of…

A: Proteins called enzymes aid in accelerating chemical processes in human bodies. For several…

Q: How do amino acids bond together? Use a diagram to show how amino acids serine, tyrosine, and…

A: Amino acids  Amino acids are the building blocks of proteins. Proteins are complex molecules that…

Q: The heme group in hemoglobin is an example of an R group.

A: The statement is False.

Q: What structure is at the core of how all senses “sense” the environment?

A: Introduction :- The senses are the physiological capacities of organisms that provide data for…

Q: A mouse sperm cells has the genotype a b c d e it fertilizes an egg with the genotype a b c d e a.…

A: The combination of genetic material from a sperm and an egg during fertilization is an important…

Q: GAP + Pi + NAD+ ⟹1,3-BPG + NADH (Reaction 1)       1,3-BPG + ADP  ⟹ 3-PG + ATP (Reaction 2) Which…

A: These two reactions are part of the anaerobic process of glycolysis, which produces a small amount…

Q: What are the phases of cell cycle? How are specific quality cell activities checked during cell…

A: The cell cycle is composed of distinct phases that are necessary for cells to divide and form new…

Q: Describe an example of each of the following: a pre-zygotic barrier to reproduction a post-zygotic…

A: A pre-zygotic barrier to reproduction refers to any factor that prevents fertilization from…

Microscopy

Microscopy is a technical field of study about the use of microscopes to observe small objects like cells and micro-organisms that are not visible to the naked eye. A microscope is used in the field of microscopy, in order to see the object or organism that cannot be seen easily. Microscopes help us to observe the fine structure of a cell and its content.