What is the sequence of the mRNA molecule synthesized from the DNA template strand 5'-TAACGGTACGAT-3'? Enter the mRNA sequence using the one-letter abbreviations for the nucleotides. 5'- UAACGGUACGAU What amino acid sequence is encoded by the mRNA molecule 5'-AACGGAUCACUAACCUAC-3'? Assume that the reading frame starts at the 5' end. Use a codon table to determine the identity of the translated peptide. Enter the amino acid sequence using three-letter abbreviations for the amino acids separated by hyphens (-). N-terminus Asn-Gly-ser-Leu-Thr-Tyr What is the sequence of the polypeptide formed if poly(UUAC) is added to a cell-free, protein-synthesizing system? poly(His-Ser-Phe-Ile) Asn-Glu-stop poly (Leu) Val-Ser-Lys-stop poly(Tyr) -3' O poly(Leu-Leu-Thr-Tyr) C-terminus

What is the sequence of the mRNA molecule synthesized from the DNA template strand 5'-TAACGGTACGAT-3'? Enter the mRNA sequence using the one-letter abbreviations for the nucleotides. 5'- UAACGGUACGAU What amino acid sequence is encoded by the mRNA molecule 5'-AACGGAUCACUAACCUAC-3'? Assume that the reading frame starts at the 5' end. Use a codon table to determine the identity of the translated peptide. Enter the amino acid sequence using three-letter abbreviations for the amino acids separated by hyphens (-). N-terminus Asn-Gly-ser-Leu-Thr-Tyr What is the sequence of the polypeptide formed if poly(UUAC) is added to a cell-free, protein-synthesizing system? poly(His-Ser-Phe-Ile) Asn-Glu-stop poly (Leu) Val-Ser-Lys-stop poly(Tyr) -3' O poly(Leu-Leu-Thr-Tyr) C-terminus

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
On the mRNA codon table below, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5’cap is indicated by (5’). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5’)CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA(3’) In a previous round of replication, DNA polymerase made a mistake and added a C on what is now the DNA template strand. In the space on the mRNA sequence below, write the added base. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5’)CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3’
Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A G
Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)
Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.
Refer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
Determine the sequence of amino acids specified by the codons in the following information strand. AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC САА Then determine the sequence of amino acids if an insertion occurred to the left of the first adenosine and changed the reading frame as shown below. Notice that (1) the insertion is shown on the left by the lower-case “i", and (2) the bases are still in the same sequence; they are just shifted so that they are read differently. IAG GTC TTC AGG GAA TGC СTG GCG AGA GGG GAG CAG СTG GTA TCG CTG GGC CCA Suppose a single-nucleotide polymorphism occurred in the original strand to make the change shown below. Would this affect the resulting protein? Explain. This is the original strand AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC CAA This is the strand with the SNP. (The change is shown in red.) AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TAG TAT CGC TGG GCC САА Suppose a different single-nucleotide…