What general conclusions can be drawn from the Eocene primates? What general conclusions can be drawn from the Oligocene primates? When did the divergence of Old World anthropoids and hominoids happen? What general conclusions can be drawn from the Miocene hominoids

What general conclusions can be drawn from the Eocene primates? What general conclusions can be drawn from the Oligocene primates? When did the divergence of Old World anthropoids and hominoids happen? What general conclusions can be drawn from the Miocene hominoids

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter31: Animal Phylogeny, Acoelomates, And Protostomes

Section31.3: An Overview Of Animal Phylogeny And Classification

Problem 1SB: Which major groupings of animals defined on the basis of morphological characters have been...

See similar textbooks

Related questions

Q: From doing his EKG in lab, Justin discovers his heart EKG has no P waves, which of the following…

A: Electrocardiography (EKG or ECG) is a vital tool in the field of cardiology used to assess the…

Q: The Eustachian tube is important for equalizing air pressure within the middle ear. True…

A: The question is asking whether the Eustachian tube plays a role in equalizing air pressure within…

Q: Which of the following statements regarding hemoglobin (Hb) saturation are true? a. On top of…

A: The question is asking us to evaluate the truthfulness of several statements about hemoglobin (Hb)…

Q: Q4

A: The question is asking to identify whether each of the given terms - Enhancer, Transcription Factor,…

Q: Trophic Cascade Concept Map Primary Producers: Include at least two different types of primary…

A: Trophic Cascade Concept Map Primary Producers:Grass (Plant):Herbivores:RabbitGrasshopperAlgae…

Q: Question 1 Table 1: Genotypes and Phenotypes for Purple and Yellow Corn Kernels Type of corn…

A: Type of cornGenotype(s)PhenotypePurple kernelsPP or PpPurple kernelsYellow kernelsppYellow kernels…

Q: The ploidy of this structure is Haploid Gametophyte Diploid Sporophyte

A: The ploidy of this structure is Gametophyte.Explanation:Let's delve deeper into the concept of…

Q: Explain how life is in the blood by using at least 5 biological key terms such as plasma,platelets,…

A: Biological Explanation:In the context of biology, life in the blood is intricately tied to its…

Q: If we are assuming 1 x 109 cells/mL for the overnight culture and knowing that a reliable countable…

A: In microbiological practices, especially when performing serial dilutions and plate counts, the…

Q: The patient who gave a positive test for 21-hydroxylase in Q3. is a 46-year-old woman. She is…

A: The objective of the question is to analyze the given patient's test results and determine whether…

Q: Which of the following is true about the pacemaker potential in the heart? a. Decreased K+ efflux…

A: The pacemaker potential, also known as the prepotential, is the slow, positive increase in voltage…

Q: Subject: Environmental Physiology For carnivores and insectivores, the water content of food is…

A: For plant feeders, the water content of food is generally very high. So, the correct answer is:(c)…

Q: It was suspected that the cause of the infertility seen in a patient was due to undiagnosed non-…

A: The question is asking us to determine the number of fragments that would be visible on an agarose…

Q: Is the textbook, An introduction to Conservation Biology (Sher 2023), primary or secondary…

A: The objective of the question is to determine whether the textbook 'An introduction to Conservation…

Q: You genetically engineer nonadhesive cells to express one variety of cadherins and then mix the…

A: The objective of the question is to understand the behavior of genetically engineered nonadhesive…

Q: 1.Protists can be _____ .(Mark all that apply.) motile non-motile flagellated ciliated 2. Protists…

A: 1. Protists can be:MotileNon-motileFlagellatedCiliated2. Protists can…

Q: A population of a species evolving toward a favored extreme trait is _____.…

A: The question is asking to identify the type of natural selection that occurs when a population of a…

Q: 3. Module 1. Ecomorobe a. Observe the morphologies of the eight different lizard species. For now,…

A: a. You observe eight lizards, four from each of two islands. Since you lack prior knowledge of their…

Q: Mutation #3 DNA template: 3' TA CGCGCTGCACGATGCAGTAGTACATC 5' mRNA transcript sequence: Amino acid…

A: Mutation #3:DNA template: 3' TA CGCGCTGCACGATGCAGTAGTACATC5'mRNA transcript sequence: 5' AU…

Q: Subject: Environmental Physiology Why is intense physical activity challenging for poikilotherms?

A: Intense physical activity is challenging for poikilotherms due to the impact of environmental…

Q: The direct formation of ATP by the transfer of a phosphate group from a donor molecule to ADP is…

A: The question is asking to identify the process by which ATP (adenosine triphosphate) is directly…

Q: Protein Synthesis and Mutation Practice Complete the lines below by determining the mRNA transcript…

A: The method of protein synthesis is central to cellular work and includes transcription and…

Q: Which of the following statements is false concerning the movement of fluid between capillaries and…

A: Fluid movement between capillaries and interstitial space is a fundamental physiological process,…

Q: Q1

A: The question is asking about the possible sources of contamination in a product. Contamination…

Q: State how salinity of soil can be measured?

A: The salinity of soil can be measured using various methods, including: Electrical Conductivity (EC)…

Q: Match the muscle type to its main characteristics Smooth muscle Cardiac muscle Skeletal muscle…

A: Match the following

Q: Subject: Environmental Physiology Explain how the differences in the thermal characteristics of…

A: The objective of this question is to understand the impact of thermal characteristics of terrestrial…

Q: Is tiktaalik more closely related to ray-finned or lobe-finned fish?

A: The question is asking about the evolutionary relationship between Tiktaalik, a prehistoric…

Q: QUESTION 1 In cucumbers, warty fruit (W) is dominant to smooth fruit (w) and dull fruit (D) is…

A: In the field of genetics, understanding how traits are inherited is often studied through crosses…

Q: what mechanism, during evolution, is most likely to have arisen

A: During evolution, the mechanism most likely to have arisen is natural selection. Natural selection…

Q: In what direction(s) did the brain evolve? How do we know which structures are "newer" in an…

A: Brain Evolution Direction and Dating MethodsBrain evolution is a fascinating story of growth and…

Q: Please use the following table to compare qualitative (Mendelian) traits and quantitative traits…

A: The external characteristics of an individual are termed as phenotype while representation of the…

Q: Disruptive selection is the promotion of _____. the standard form of a trait…

A: Disruptive selection, also known as diversifying selection, is a type of natural selection that…

Q: Complex reflexes require the involvement of receptors, sensory, motor, excitatory, and inhibitory…

A: The objective of the question is to determine whether complex reflexes require the involvement of…

Q: Allowing all drunk-driving suspects (driving erratically) to complete the above sobriety test in 60…

A: The question is asking about the potential effects of extending the time allowed for a sobriety test…

Q: What aspects of food analysis and quality assurance should be explored in order to contribute…

A: Today's market is a global market and lots of processed foods are available to choose from. It is…

Q: Legal and Ethical Issues A nurse is caring for a client who is dying. The family is demanding that…

A: The objective of the question is to identify possible solutions, applicable ethical principles, and…

Q: Which of the following is NOT a physiological process linked to the onset of disease? Group of…

A: The objective of the question is to identify which among the given options is not a physiological…

Q: A 10 month old child whose external genitalia were ambiguous had hypertension and no dehydration. He…

A: The objective of the question is to understand the reason behind the child's hypertension and lack…

Q: A patient's antibody screen is resulted as positive. What should be done to test units for…

A: The objective of the question is to determine the correct procedure to follow when a patient's…

Q: 6. The CO2 released when we exhale is produced by:a) Glycolysis (glucose to pyruvate)b)…

A: The objective of the question is to identify the biological process that leads to the production of…

Q: What do horses diets consist of and how do their teeth relate to it.

A: The question aims to understand the diet of horses and how their dental structure supports their…

Q: The steep part of the O2-Hb dissociation curve... a. is where CO2 unloading occurs at the tissue…

A: The question is asking about the characteristics of the steep part of the oxygen-hemoglobin (O2-Hb)…

Q: Academy of Sciences https://doi- org.ezproxy.library.yorku.ca/10.1073/pnas.231743012) has…

A: Deletion of 25 base pair nucleotides is a kind of deletion mutation which may cause the recessive…

Q: Fill in the volumes required to make the standard glucose solutions of various conentrations…

A: Tube labelVolume of 2.00mg/mL stock solutionVolume of Milli-Q waterStd 10.000320 microliterStd…

Q: GABA and glutamate usually have excitatory effects. a. True b. False

A: The question is asking whether both GABA (gamma-aminobutyric acid) and glutamate typically have…

Q: Depurination of purine bases results in an apurinic site. Assume a single depurination event occurs…

A: The objective of the question is to determine the DNA sequences that will exist after two rounds of…

Q: Scientific studies have shown that the majority of human genetic differences worldwide exist within…

A: The objective of the question is to determine whether the majority of human genetic differences…

Q: Select the correct answer from each drop-down menu. Offspring inherit genes from their parents, and…

A: Mendel's laws, developed by Gregor Mendel in the nineteenth century, transformed genetics. The law…

Q: QUESTION 12 A researcher named Erwin Chargoff determined the relative proportion of the different…

A: • Percentage of Cytosine (C): 24%• Percentage of Adenosine (A): 24%• Percentage of Thymine (T):…

Concept explainers

Primate evolution

Primates are a relatively new species and first appeared in the fossil record nearly 55 million years ago. They may have originated as far back as the cretaceous period. Their fossils were observed in North America, Asia, and Europe. Long before the first monkeys and their prosimian relatives developed, most animal species thrived and died. The first primates did not exist until about 50-55 million years ago, even though the planet is 4.54 billion years old and the first life goes back at least 3.5 billion years. Dinosaurs had been extinct for 10 to 15 million years when this happened.

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Eocene Primates:

VIEW

Step 2: Oligocene Primates:

VIEW

Step 3: Divergence of Old World Anthropoids and Hominoids:

VIEW

Step 4: Miocene Hominoids:

VIEW

Solution

VIEW

Step by step

Solved in 5 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Why is the Fayum depression in Egypt such an important site for understanding the origin and diversification of anthropoid primates?
What are three traits (besides a post-orbital bar) that are DERIVED traits when COMPARING primates to non-primates, but are ANCESTRAL traits WITHIN the primates?
What trait separates amphibians from primates on this cladogram? What separates rabbits and primates from crocodiles on this cladogram? Which organism is most related to the bird on this cladogram? What 5 traits do these two organisms share? Which organism will have DNA most similar to the bird? Which organism's DNA will differ the most from the bird?
Below is a phylogenetic tree of primates. Bush babies, lemurs, pottos Tarsiers Monkeys Gibbons Family Hylobatidae Orangutans Subfamily Ponginae Gorillas Family Hominidae Tribe Gorillini Chimpanzees Tribe Panini Subfamily Homininae ko Humans Tribe Hominini Which of the following is NOT a monophyletic group? O Gorillas, orangutans, gibbons, humans, chimpanzees O humans Gibbons, orangutans, monkeys Chimpanzees, humans Strepsirrhini Haplorrhini Anthropoidea Hominoidea
a)Describe key developments related to primate evolution associated with the time periods below: Palaeocene: Eocene: Oligocene: Miocene: b)List plausible descendants to these ancestral primates: Omomyyoid: Adapiform: Aegyptopithecus: Khoratpithecus: Proconsul:
Tarsiers are primates with unusual anatomical characteristics whose taxonomic classification has been heavily debated. How might the Tarsier example affect our interpretation of the fossil record of the early euprimates?
Discuss: How old are the oldest camel fossils shown? How has the skull changed over time? How have the teeth changed over time? How have the leg bones changed over time? Table 15.1 Fossils are used by scientists to understand how camels evolved. Table 15.1 Camel Evolution Age Paleocene 65 million years ago Eocene 54 million years ago Organism Skull and teeth Limb bones Oligocene 33 million years ago Miocene 23 million years ago Present
What is a primate and why do anthropologists consider it important to study them? What features do primatologists look for to distinguish between prosimians, new world monkeys, old world monkeys and apes?
If the genus Australopithecus is considered an outgroup, what are THREE shared derived characters of the genus Homo? Include at least one behavioural character in your list. Explain what makes the characters you've selected shared derived characters. (detailed paragraph format explanation ) max 500 words
How is the traditional animal family tree similar or different from the phylogeny reflecting molecular data?
Which of the following is true about the phylogeny of birds and reptiles. Question 35 options: a) Birds are more closely related to amphibians then they are to reptiles. b) Birds are a type of reptile, but are not related to dinosaurs. c) Birds and reptiles are the least related vertebrates. d) Birds are a type of reptile and are descended from a group of dinosaurs.
Describe 4 ways that tend to distinguish each of the following taxonomic groups: all primates from other mammals; strepsirrhines from haplorhines; catarrhines from platyrrhines; colobines from cercopithicoids; hominoids from other primates.