Q: what advantages do regulatory systems provide to the organisms?
A: Introduction :- The neurological system and the endocrine system work in tandem to control and coord...
Q: Discuss the Steps for Equipment Selection as well as Equipment Utilization in a 1000 bedded hospital
A: Defining the need Surveying the standard guidelines. Search for possible product providers Inspectio...
Q: Can you help me identify the specific structure pointed
A: This is transverse section of kidney. The labelled pointed section attached below.
Q: Choose all that apply Which bones make up the shoulder/pectoral girdle? Group of answer choices Os C...
A: The shoulder or pectoral girdle is a set of bones that connects the upper limbs to the bones along t...
Q: Question is attached
A: The lac operon is an Operon or a collection of genes with a single promoter. The genes in the operon...
Q: see photos
A: DNA RNA SUGAR Deoxyribose Ribose BASES Consists of 4 bases namely:- Adenine(A), Guanine(G), Cy...
Q: 1. Where and when did photosynthesis first evolve? What are some lines of evidence that support this...
A: The term photosynthesis is associated with a process that can be observed in several living organism...
Q: A molecule that donates electrons becomes____ , and the one that accepts the electrons becomes_____ ...
A: Redox reaction consist oxidation and reduction reaction. Photosynthesis is an excellent example of r...
Q: Why would adults be more likely to have an allergy to an insect venom than a child? Give one hypoth...
A: Anaphylaxis is a severe allergic reaction, which occurs in body as response to insect venom.
Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...
A: The malting temperature (Tm) of the DNA is the temperature at which at least 50% of dsDNA is conver...
Q: What is the number and types of lamprey species that are present in the Great lakes?
A: ANSWER;- 1. 5 number present in the Great lakes. Many people believe the obtrusive ocean lamprey is ...
Q: 1. Why is direct flaming preferred when disinfecting loops and needles? 2. Why is it important to fl...
A: 1.Direct flaming is preferred for disinfecting needles and loops because that completely kills all t...
Q: Explain how fungi are able to reproduce so effectively and so abundantly. Your answer
A: Fungi (singular: fungus) are a kingdom of generally multicellular eukaryotic creatures that are hete...
Q: What are CRISPR-associated (cas) genes ?
A:
Q: Which of the following are bones of the appendicular skeleton? (Choose all that apply) Group of answ...
A: Introduction: Appendicular skeleton system consists of the limbs (along with the limb bones and gird...
Q: b. The net protein product is significantly toxic c. The number of faulty transcript is limit...
A: .c. Condensins During M phase of cell cycle condensin proteins maintained chromosome in condensed st...
Q: Which one of the following may produce "wrinkled" colonies on medium? Select one: O A Chlamydia O B....
A: As per our guidelines, we are supposed to answer only one question. Kindly repost other questions as...
Q: Differences between human male and female chromosomes.
A: Chromosomes is thread like structure in shape which is present in the nucleus and contain DNA Genes...
Q: What happens if the body's cellular respiration system malfunctions? Explain your answer
A: Malfunction is defined as something stops working. Cellular respiration is process which occurs to b...
Q: Upon rotation the spinous went more to the left and to the left upon lateral flexion. What is the li...
A: The term spine is associated with the body’s backbone that is positioned on the dorsal side. In musc...
Q: At the metaphase plate during metaphase I of meiosis, there are Select one: A. Chromosomes consistin...
A: Meiosis is a reduction division .it is occured in germ cells of our body. During metaphase 1 of mei...
Q: Which level(s) of protein structure can you find the a helix and the B pleated sheet? CHECK ALL THAT...
A: Introduction:- A protein molecule is much larger than a sugar or salt molecule, and it is made up of...
Q: What was Darwin “wrong” about The Tree of Life?
A: The common descent theory, also known as the theory of evolution, is a well-known theory developed b...
Q: 1. Explain the differences in the mechanisms of conjugation, transformation, and transduction.
A: Explain the differences in the mechanisms of conjugation, transformation, and transduction.
Q: To avoid or lessen sunburn while in the aquatic facility, generously apply sunscreen. Reapply every ...
A: The first statement is correct as the generous application of sunscreen avoids and lessens sunburn. ...
Q: Are the morphological characteristics of a sponge enough to identify it up to the genus level? Why o...
A: The morphological characteristics of a sponges are used to identify it up to the genus level but mor...
Q: In a population of geese, the narrow-sense heritability for wing span is shown to be 0.5. If the phe...
A: The formula that can be used to calculate narrow-sense heritability is equal to: h2=VAVP Here h2 eq...
Q: Explain your answer. Below is a pedigree showing the inheritance of colorblindness in Akoto family. ...
A: Pedigree is a family chart showing the inheritance of a particular trait through several generation ...
Q: Describe the ways that membrane proteins associate with the lipid bilayer.
A: The cell membrane, also known as the plasma membrane, separates the interior of the cell from the ou...
Q: Explain The Discovery of CRISPR ?
A: The common technology that can be used to edit genes is refers as the CRISPR. In other words you c...
Q: Identify the mRNA sequence that encodes the protein Design primers that will allow them to amplify t...
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each o...
Q: 1. Which type of evidence for evolution is most accurate in determining evolutionary relationships-m...
A: There are many arguments in the past about which type of evidence is most accurate in determining ev...
Q: Collectively, all the tints, shades and tones of a hue are said to be a (n) _____ color scheme. A. ...
A: All the colours (tones, tints, and shades) of a single hue are called monochromatic colours. Monochr...
Q: If RR stands for red, RR' stands for roan and R'R' stands for white; as well as B stands for bucking...
A: dominant stands for a characteristic that is more likely to be expressed in the offspring than the r...
Q: Compare the cyclic and noncyclic light-dependent reactions
A: Introduction: As the anabolic reaction that transforms solar light energy into cellular chemical ene...
Q: How does the swim bladder varies in different aquatic environments?
A: The swim bladder or air bladder is an internal gas filled organ that contributes to the ability to c...
Q: Continuing his experiments, in Miles Morales' genome, the Goblin found similar genes, including one ...
A: Here we will calculate the chi-square value to determine, whether invisibility is linked to agility,...
Q: CO2 that is absorbed by red blood cells, most is grabbed by an enzyme and converted to
A: Ans. D. Carbonic acid which splits into hydrogen (H+) ions and bicarbonate ions
Q: What is spacer acquisition ?
A: Spacers are short sequence sections which look like phage or plasmid DNA. Every spacer is surrounded...
Q: 5. Molecular Evidence. Cytochrome c is a protein located in the mitochondria of cells involved with ...
A:
Q: haded in black-white trait (Glucose-6-phosphate dehydrogenase deficiency) 1. What is the genotype o...
A: Genotype : The set of genes in our DNA responsibilities for a particular trait is known as genotype....
Q: In cats, fur color is a sex-linked trait, where black fur is dominant over yellow fur. If a calico f...
A: The coat color of cat is an X-linked trait. Males are hemizygous (one X chromosome and another Y ch...
Q: How does the dermis of our skin relate to its functions of protection, temperature control, waste re...
A: Dermis of our skin helps body to stay fit and healthy in some manner that are discussed below-
Q: Explain how streams can cleanse themselves andhow these cleansing processes can be overwhelmed.What ...
A: "Since you have asked multiple question, we will solve the first question for you. If you want any s...
Q: Describe what happens when a pigment that is part of a lightharvesting complex absorbs light.
A: Photosynthesis is the conversion of light energy into chemical energy by phototrophs, which is then ...
Q: In mice, brown fur color is dominant to black fur color. Another gene affects the production of pigm...
A: The brown fur (BB) color is dominant to black fur (bb) color while pigment production (BB, Bb) is do...
Q: Table 2. Starter plate conditions. Starter Plate Bacterial Cas9 DNA Repair System SGRNA Donor Plate ...
A: Q.
Q: Describe how a natural disaster can create an ecological disturbance, and how this can impact biodiv...
A: A geographic area where plants, animals, and other organisms, as well as abiotic factors work togeth...
Q: The process of transferring DNA from one bacterium to another through a bacteriophage is called O co...
A: Bacteriophage are obligate intracellular viruses that infect bacteria. Phage is surrounded by a prot...
Q: . A short homologous sequence called the macrohomologies which connects break ends of the strands. ...
A: Short Homologous sequence Is known as Microhomology sequence. It involves asingment of microhomolog...
WHAT ARE THE CONCEPT, APPLI AND IMPORTANCE OF THE FOLLOWING?
I. Translocation through an artificial membrane
a. Osmosis
b. Dialysis
II. Translocation through the cell membrane
a. Animal Cell
b. Plant Cell
c. Diffusion
d. Surface tension
Step by step
Solved in 3 steps
- WHAT ARE THE CONCEPT AND IMPORTANCE OF THE FOLLOWING?I. Translocation through an artificial membranea. Osmosis b. DialysisWhich of the following types of transporters would be utilized to move two different types of molecules across the cell membrane in the same direction? a. Uniporter b. Symporter/Cotransporter c. Antiporter d. Chemiporter e. ProtoporterWhich membrane structures is largely involved in osmosis? Select one: O A. integrins O B. glycoproteins O C. glycolipids O D. peripheral proteins O E. aquaporins
- Which of the following is not a passive transport process? O a. Phagocytosis O b. Filtration O C. Dialysis O d. OsmosisThe passive, non-mediated movement of particles into or out of a cell following the particle’s concentration gradient is called A. osmosis B. vesicular transport C. filtration D. diffusion E. facilitated diffusion F. active transport1.There are different processes for transport of molecules of ions across cell membranes. Explain briefly each process a. Simples diffusion b. Facilitated diffusion via carrier proteins c. Facilitated diffusion via ion channels d. Primary active transport e. Secondary active transport f. Endocvtosis g. Exocytosis h. Transcytosis 2. List four Physical factors that affect the rate of diffusion and how they will affect it. 3. What kind of molecules can pass through the plasma membrane of the cells through simple diffusion? Give brief discussion. 4. List the three main parts of a cell and explain their functions. 5. Define an organelle. Which organelles are surrounded by a membrane and which are not? 6. What is the key difference between passive and active process? 7. Why RNA transcription can still serve the needs of the cell even if its operation is slow compared to DNA?
- Glucose is often present in very low concentrations in environments populated by microorganisms. To import the maximum amount of available glucose, cells use a. Receptor-mediated endocytosis b. Simple diffusion c. Osmosis d. Facilitated diffusionDefine the following terms: a. semipermeable membrane b. hypotonic c. hypertonic d. crenation e. hemolysisThe passive non-mediated movement of particles across a membrane driven by pressure is A. filtration B. diffusion C. facilitated diffusion D. osmosis E. active transport F. vesicular transport
- The energy requiring mediated movement of small particles into or out of a cell up their concentration gradient is called A. diffusion B. facilitated diffusion C. active transport D. osmosis E. vesicular transport F. filtrationDifferentiate the following in terms of description and properties. a. Diffusion b. Active transport c. Osmosis d. ImbibitionPlease answer the following multiple choice question: Which of the following processes requires protein carriers to move materials up their concentration gradient? A. active transport B. osmosis C. endocytosis D. facilitated difussion