Using RNA interference, it is possible to significantly reduce homologous mRNA transcripts and thereby reduce the expression level of a specific gene of interest. What methods could be used to confirm that an RNAi knockdown experiment has been successful? genome sequencing labeling the RNAi construct western blotting quantitative real-time PCR The relative ease of RNAi studies means that large-scale screens can be performed to assess a wide array of targets. What source would produce the most functional RNAi library for conducting genome-wide screens? microRNAs whole-genome proteins whole-genome DNA whole-genome cDNA

Using RNA interference, it is possible to significantly reduce homologous mRNA transcripts and thereby reduce the expression level of a specific gene of interest. What methods could be used to confirm that an RNAi knockdown experiment has been successful? genome sequencing labeling the RNAi construct western blotting quantitative real-time PCR The relative ease of RNAi studies means that large-scale screens can be performed to assess a wide array of targets. What source would produce the most functional RNAi library for conducting genome-wide screens? microRNAs whole-genome proteins whole-genome DNA whole-genome cDNA

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 20QP: Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant...

See similar textbooks

Similar questions

Describe the primary procedure(key steps no details) that you will follow to clone the C-peptide gene from the RNA above into the only vector you have, a pUC expression vector cut open usingEcoR1which has a 5¢-recognition site and a 3¢- Hind III in the MCS?
Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant sickle cell anemia allele of beta globin. This mutation destroys an MstII restriction site normally present in the beta globin gene. This difference between the normal allele and the mutant allele can be detected with Southern blotting. Using a labeled beta globin gene as a probe, what differences would you expect to see for a Southern blot of the normal beta globin gene and the mutant sickle cell gene?
Primers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAA
Genome-wide RNAi screens target expression of > 16,000 genes. Explain how each of these 16,000+ bacterial strains would be engineered in order that they only cause gene silencing of the intended target.
Describe the rationale behind the electrophoretic mobility shift assay.
1. You are investigating a protein that has the amino acid sequence N ... Ala – Thr - Asn – Trp – Lys - Arg - Gly – Phe – Thr ... C within its primary structure. You found that several of the mutations affecting this protein produced shortened protein molecules that terminated within this region. In one of the mutants, the Asn became the terminal (last) amino acid. (a) What DNA single-base changes(s) would cause the protein to terminate at the Asn residue? (b) What other potential sites do you see in the DNA sequence encoding this protein where mutation of a single base pair would cause premature termination of translation? >
CA Live Remote Consider the following chart: What type of mutation is this? * DNA: TAC GCA TGG AAT MRNA: AUG CGU ACC UUA Amino acids: Met-Arg-Thr-Leu DNA: TAC GTA TGG AAT MRNA: AUG CAU ACC UUA Amino acids: Met - His - Thr- Leu substitution deletion insertion frameshift mutation
Find some unclear points in the "initial transcription by RNA polymerase proceeds through a DNA- scrunching mechanism" paper and rate the overall paper "A(excellent) to D(just fine) based on findings, results, and methods they discussed. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2754788
In Northern blot analysis, mRNA samples from tissues are bound to a labeled DNA probe that is complementary to the mRNA, and run on a gel to be visualized. The protein tropomyosin is known to be present in both brain and liver. When brain and liver tissue were assayed for the presence of tropomyosin mature mRNA, bands of two different sizes were seen. Tropomyosin gene diagram (3000 bp total): Shown in attatched image If the band on the Northern blot for mRNA isolated from liver tissue is 2580 bp, whereas from brain tissue the band is 2250 bp, what is most likely? a)The two mRNAs are made from different tropomyosin DNA sequences. b)Exon 2 is alternatively spliced out of the brain mRNA. c)Introns 1 and 2 are spliced out of the brain transcript but not the liver transcript. d)Exons 1 and 3 are spliced out of the brain transcript but not the liver transcript. e)Exon 2 is alternatively spliced out of the liver mRNA.
To determine the reproducibility of mutation fre-quency measurements, you do the following experiment.You inoculate each of 10 cultures with a single E. coli bac-terium, allow the cultures to grow until each contains 106cells, and then measure the number of cells in each culturethat carry a mutation in your gene of interest. You were sosurprised by the initial results that you repeated the experi-ment to confirm them. Both sets of results display the sameextreme variability, as shown in Table Q5–1. Assuming thatthe rate of mutation is constant, why do you suppose thereis so much variation in the frequencies of mutant cells indifferent cultures?
An electrophoretic mobility shift assay can be used to study the bindingof proteins to a segment of DNA. In the results shown here, anelectrophoretic mobility shift assay was used to examine the requirementsfor the binding of RNA polymerase II (from eukaryotic cells)to the promoter of a protein-encoding gene. The assembly of generaltranscription factors and RNA polymerase II at the core promoteris described in Chapter 14 (Figure 14.14). In this experiment, thesegment of DNA containing a promoter sequence was 1100 bpin length. The fragment was mixed with various combinations ofproteinsand then subjected to an electrophoretic mobility shift assay.Explain which proteins (TFIID, TFIIB, or RNA polymerase II) areable to bind to this DNA fragment by themselves. Which transcriptionfactors (i.e., TFIID or TFIIB) are needed for the binding ofRNA polymerase II?
Recall that constructs used for floxing a gene contain,within one of the gene’s introns, two loxP sites flanking a gene for neomycin resistance (Fig. 18.11a). AloxP site is only 34 base pairs long, as shown in thefollowing figure.ATAACTTCGTATA ATGTATGC TATACGAAGTTATInverted repeat Spacer Inverted repeatExplain how you could use PCR to generate a neomycin resistance gene flanked by loxP sites, starting witha plasmid containing a neorgene. If you had the intronof the target gene cloned in a plasmid vector, howcould you insert your PCR product into the intron?