This is an SDS-PAGE gel of the protein insulin. The first lane is the molecular weight standard marker. The second lane NR is the native, non-reduced protein (MW 5.7kDa). The third lane is the protein treated with beta-mercaptoethanol. Please explain what is shown in the
Q: Your hospital Vice-President for Population Health asks you to research and evaluate the most…
A: The Community Health Needs Assessment (CHNA) is an important tool for not-for-profit hospitals to…
Q: After a meal that contains carbohydrates, blood glucose levels usually rise gradually as…
A: Introduction : Carbohydrates are a large group of naturally occurring organic compounds that are…
Q: Which of the following represents the correct order of the phases of the cell cycle
A: Introduction: The cell cycle is the sequence of events that a cell goes through as it grows and…
Q: The term "histone code" is best described as: O The sequence of amino acids found within a histone…
A: Genetics may aid in understanding species evolution: By examining the genetics of various species,…
Q: Explain exactly what the X25 probe is and how it allows for visualization of mRNA from the patients.…
A: Frataxin is a mitochondrial protein responsible for iron binding. When the expression of this…
Q: metaphase II anaphase II B Phase C Phase E sister chromatids align at the center of the cell since…
A: Introduction:- Cell cycle is defined as the series of sequential regulated events that involves cell…
Q: Define the term 'oedema' and in your response show your understanding how liver disease can…
A: Oedema is defined as it is abnormal accumulation of watery fluid in the serous cavity or…
Q: A genetic mutation leading to under expression of a cell membrane receptor would have the most…
A: Introduction :- Genetic mutation refers to a permanent change in the DNA sequence that makes up a…
Q: How do the following substances move across the plasma membranes of animal cells? a. CO₂ b. H₂O c.…
A: Terms involved in this process; Diffusion: it is a process in which movements of molecules from an…
Q: Which of the following statements regarding contraction of skeletal muscle cells is NOT true: (more…
A: Introduction In our body we have three types of muscle, cardiac muscle, smooth muscle and skeletal…
Q: In sentence one discuss whether or not that you should be concerned about eating traditionally grown…
A: Our food supply is constantly evolving, and with all the new products available, it can be difficult…
Q: What are the ethically approved methods of slaughtering animals? Which of them have you seen…
A: Slaughtering animals is the act of killing animals for food or other purposes. This is a contentious…
Q: INSTRUCTION: - Answer the question properly - Discuss your answer - Do not copy in Google or here in…
A: The following question asks for a description of a hypothetical fossil of a whale skull and its…
Q: Which of the following is NOT correctly matched? Sterilization - destruction or removal of all forms…
A: According to Bartleby guidelines only the 1st question can be answered. Please repost the remaining…
Q: Explain why the phenotypic frequency of the tuskless trait is increasing in the African elephant…
A: The change in the character of an organism over generations is called evolution. The evolution of…
Q: Determine the scores and profile number for the strip result table shown bellow
A: The identification of the pathogen is important for the proper treatment of a disease. In order…
Q: What is the purpose of: A. The concentrated salt solution? B. adding isopropyl alcohol to the…
A: Introduction: DNA extraction is a process in which the DNA is separated from other cellular…
Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…
A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…
Q: A cell undergoing division has a haploid chromosome number of 15. Give the numerical value for each…
A: Meiosis is a type of cell division that is also known as reduction cell division. This because a…
Q: Which of the following statements best describes chylomicrons? A type of lipoprotein that transports…
A: An enzyme is a biological molecule (typically a protein) that catalyzes (accelerates) chemical…
Q: Briefly describe the short term regulation of blood pressure and relate the failure of these…
A: Short-term regulation of blood pressure is controlled by the autonomic nervous system. Blood…
Q: Which of the following statements is true? human biological races exist and it is possible to…
A: ANSWER) There is nothing like biological race, there is no differentiation among the individuals on…
Q: The pedigree below represents an autosomal recessive disease. What characteristic(s) of the pedigree…
A: Pedigree analysis is the study of family patterns of genetic inheritance, particularly with regard…
Q: Simplify that answer please
A: Introduction COVID-19 (Coronavirus Disease 19) is a highly infectious respiratory illness caused by…
Q: 7. In the binomial naming system, scientific names are written in italics, with the first word…
A: Introduction : A species is classified and named using the binominal nomenclature system, which…
Q: Compare artificial selection and natural selection
A: Selection In biology, selection refers to the survival and reproduction tool of individuals having…
Q: The pedigree below shows the inheritance of the rare blistering disease (epidermolysis) in dogs.…
A: Introduction A gene exists in two alternative forms called allele. If both the alleles of a gene is…
Q: What is the genetic mechanism behind BWS and RSS in Parental imprinting?
A: Genomic imprinting is the term used to describe the epigenetic marking of genes that leads to…
Q: (3) If a DNA sequence is 5' TCC GGT CAT 3' what are the RNA and protein sequences that can be made…
A: Introduction : In the field of molecular biology, the process by which DNA is transformed into RNA…
Q: 3. What is a correct implication of Chargaff's analysis of base compositions of DNA? Base pairing is…
A: Introduction : Deoxyribonucleic acid, or DNA, is the genetic material found in humans and the…
Q: What biomolecule are promoters and enhancers composed of?
A: Biomolecules are organic compounds present inside the cells of the living organism. Protein, lipids,…
Q: please explain the catalytic mechanism of phenylalanine hydroxylase in detail. thank you!…
A: Introduction: An enzyme is a biological molecule that acts as a catalyst to speed up the rate of…
Q: True or false: from the film "Making of the Fittest", dark mice are more likely to survive in the…
A: INTRODUCTION Dark mice are a breed of mouse commonly used in laboratory experiments. They are…
Q: How is collenchyma and sclerenchyma tissue similar
A: Collenchyma, parenchyma, and sclerenchyma are permanent tissues forming the ground tissue in the…
Q: 1. Explain how a large increase of the moose population in a region could have an impact on the…
A: Ecosystem is the community of living organisms,which interact with each other as well as the…
Q: rial dilutions: two 10-fold dilutions, followed by a 5-fold dilution, followed by 2-fold dilution.…
A: given that there are 35 cells but volume is not mentioned so let's assume 35 cells are present in 1…
Q: Which of the situations below will enhance microtubule growth? O addition of a drug that inhibits…
A: The third key part of the cytoskeleton, microtubules, are hard, hollow rods with a diameter of…
Q: What happens when you eat? How does a breakfast of scrambled eggs with spinach and multi-grain toast…
A: Introduction :- Mechanical digestion is the physical breakdown of food into smaller pieces. It…
Q: Basic body color for horses is influenced by several genes, one of which has several different…
A: It is a question related to the incomplete dominance which are heterozygous conditions are shows.
Q: If a culture of E. coli you are tracking grows from 5 x 103 cells/ml to 9 x 107 cells per ml in 4…
A: E Coli: In the lower intestine of warm-blooded organisms, Escherichia coli, also known as E. coli,…
Q: How are the blood drops at different heights alike?
A: Answer: One of the body's connective tissues is blood, which is made up of cells and cell fragments…
Q: Can the mosquito speak? What about the earthworm and malaria plasmodium
A: Speaking is an art and it is a cognitive ability that is controlled by the broca's area present in…
Q: What biomolecule composes RNA pol II and TFs?
A: Introduction: The process of gene expression uses genetic information stored in the DNA sequence to…
Q: What are the receptors involved in long term alcohol use binding and between GABBA agonist receptor…
A: We need to describe the receptors involved in long-term alcohol use interaction, as well as the…
Q: Unlike mammalian red blood cells, the red blood cells of amphibians contain large nuclei. Speculate…
A: INTRODUCTION Animals that can live both on land and in water are known as amphibians. They have a…
Q: Craig Venter's group reported sixfold coverage of the H. influenzae Rd genome. Given that the genome…
A: Craig Venter's group was able to sequence the human pathogen Haemophilus influenzae Rd genome with…
Q: What is a pathogenic fungus and how are they different from viruses and bacteria?
A: A microorganism, often known as a microbe, is basically a tiny organism. The term "microbiology"…
Q: Pyruvate to phosphoenolpyruvate conversion reaction could be coupled to reaction for the synthesis…
A: Free energy please a very important roll in deciding whether a reaction will proceed or not. Free…
Q: d. You have a 10 gram/ml. stock solution of protein. To make 50mL of 25 mg/ml solution, add, of…
A: We are given a 10gm/ml stock solution of protein. We have to makea 50 ml solution with 25mg/ml…
Q: 1.1. Every day, millions of neurons of brain cells die that are why our body tends to reproduce them…
A: Introduction The following are some of the defining characteristics of living organisms: Cellular…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- A tetrapeptide, glutamate-glycine-alanine-lysine, is prepared at at concentration of 1 mM (0.001 M) and is measured in the standard setup (pathlength of 1 cm). What is the approximate absorbance of this peptide at 280 nm? Hint: if the peptide contained a single tryptophan, the answer would be about 10. 10 280 1 0This graph represents a standard curve from a BCA assay for protein concentration. If your BCA reaction with your unknown protein has an absorbance of 0.2, approximately what concentration of protein is in your unknown sample? Absorbance (562nm) 0.5 0.45 3 0.35 0.3. 0.25 0.15. 0.1- 0.05 ~0.1 μg/ml ~4.5 μg/ul less that 0.005 | 0.2 μg/μ. [Protein (BSA)) (pg/ml)Paclitaxel is used to treat ovarian cancer by infusion at a concentration of 0.6 mg/mL over 24 hours. A dose of 135 mg/m² has been prescribed for Sero. Sero is 1.06 m tall and weighs 92 kg. Paclitaxel comes in vials of 150 mg/25 mL. Calculate the volume of 5%w/v glucose solution that would be required to dilute the concentrated solution to prepare an paclitaxel solution of the required strength.
- Paclitaxel is used to treat ovarian cancer by infusion at a concentration of 0.6 mg/mL over 24 hours. A dose of 135 mg/m² has been prescribed for Sero. Sero is 1.06 m tall and weighs 92 kg. Paclitaxel comes in vials of 150 mg/25 mL. Calculate the volume of 5%w/v glucose solution that would be required to dilute the concentrated solution to prepare an paclitaxel solution of the required strength. Answer: You did not give the correct unit. The correct answer is: 333 mL XA mixture of five proteins are analyzed by MALDI-TOF. Their molecular weigths are 3 kD, 22 kD, 100 kD, 225 kD and 515 kD. A peak appears in the mass spectrum at 33.3 kD. Which protein most likely gave this peak?Various concentrations of recombinant human insulin were prepared for use standards for an HPLC method. To verify the prepared concentrations, the samples were analyzed by measuring the absorbance at 280 nm in a short path length (5 mm) cuvette. The molar absorption coefficient for human insulin is approximately 5.875 x 10³ M-¹cm-¹. a. Calculate the extinction coefficient in mL mg-¹cm-¹. b. Calculate the concentrations of the following human insulin standards if the measured absorbances and dilutions used are: Standard 1 Standard 2 Abs. (at 280 nm) of Diluted Sample 0.305 0.685 Dilution 145.0 µL sample, 25.0 μL buffer 130.0 µL sample, 40.0 μL buffer
- I need to prepare a standard calibration curve for gamma globulin. absorbances on Y and mg of standard protein per assay on X. used 0.1mg/ml gamma stock for tubes 2-6. (Water (ml), gamma (ml), Abosrbance)--> (.036, .004, .290) (.036, .008, .358) (.024, .016, .341) (.016, .024, .520) (.008, .032, .597) - What is the math and how do you get the standard curve?Which of the following is incorrect about blood glucose test interpretation A) fasting plasma glucose 6.1-6.8 defined as having IGT and should probably be screened again after a year or so. B) 2 results>7mmmol/l defined as having diabetes C) fasting plasma glucose >6mmol, recall for further test. D) fasting or random plasma glucose, on one reading of <11.1mmol/l is diagnostic of diabetesGiven the Ramachandran Plot below, identify the protein components that could adopt the phi-psi angle combination indicated by the number 3.
- Discuss the functions and components of Biuret dye in protein content determination. Identify two other methods of protein determination and differentiate them from Biuret method. Why is BSA used as standard for protein content determination? Can other proteins be used instead?Cimetidine is used in the treatment and management of gastric ulcers and gastroesophageal reflux disease. In the case of an active ulcer, cimetidine can be administered continuous by IV infusion at a dose rate of 37.5 mg/hr. If the concentration of the cimetidine solution is 6 mg/ml, then how many milliliters must be available for a 4-hr infusion?Misoprostol is used to prevent NSAID-induced gastric ulcers. A daily dose consists of two tablets administered four times each day. What is the size of one day’s dose if each tablet contains 100 mcg of misoprostol?The following table provides data on three popular protein supplements. (Figures shown correspond to a single serving.) Protein (g) Carbohydrates (g) Sodium (mg) Cost ($) Designer Whey(Designer Protein) 20 6 90 0.80 Muscle Milk(Cytosport) 16 10 80 0.90 100%Whey Gold Standard(Optimum Nutrition) 24 3 210 1.00 You are thinking of combining Designer Whey and Muscle Milk to obtain a 3-day supply that provides exactly 200 grams of protein and 86 grams of carbohydrates. How many servings of each supplement should you combine in order to meet your requirements? Designer Whey _____servings Muscle Milk ______servings What will it cost? _______