The residual end of a pre-mRNA transcript is digested by the following enzyme
Q: 23. The following data describe the cleavage of peptide bonds in small peptides by the enzyme…
A: Introduction: Serine proteases are a large group of enzymes that cleaves the amide bond and…
Q: Which polymerase transcribes genes with internal control regions (ICR)? O RNA Pol I RNA Pol III RNA…
A: The eukaryotic cells have three distinct RNA polymerases that transcribe different sets of genes.
Q: [S] Vo vo with I 0.00 0.00 0.00 1. 15 2. 14 0. 60 0. 25 0. 50 1. 15 2. 14 3. 75 6. 00 8. 57 1.00…
A: The plot is given in step 2
Q: What are the major functions of lipids?
A: Lipids are essential fats that play significant roles in the human body. It's a prevalent…
Q: 1-How is a total cholesterol test different from a lipid panel?
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 1. List several methods (other than Bleeding Time -Ivy method, Capillary Tube Method, Lee and White…
A: Introduction: Bleeding time: It is the time interval between the skin puncture and spontaneous,…
Q: Fructose, sucrose, lactose, xylose, and glucose were tested using Benedict's, Barfoed's, Bial's, and…
A: Carbohydrates are the organic compounds and is the main source of energy for the body. They occur in…
Q: 44. Roy's doctor recommended that he watch his blood cholesterol level because his of reading of…
A: In a person, the total level of cholesterol should be always less than 200 mg/dL for a healthier…
Q: Morphine (give structure) and enkephelin (give structure) both are antagonists of the m opioid…
A: Morphine is pain medication which is used in Treatment of pain.this is belongs to opiate family.…
Q: List down the specific functions of the component structures of mitochondrion relative to cellular…
A: The mitochondrion is a membrane-bound organelle. It is called as powerhouse of the cell, it plays a…
Q: Describe the roles of calcium in the cell, and the mechanisms that the cell uses to control…
A: Calcium is a vital nutrient that aids in the mineralization of the skeleton. Over 99 percent of the…
Q: Explain the meaning of metabolic interconversion
A: Metabolism is the body's cells is used for changing the food into energy. The human bodies need this…
Q: 5. Salivary a-amylase cleaving a(1 example for which type of specificity? a) Group specificity b)…
A: Group specificity : Enzyme will catalyze the reaction on a function group of different molecules…
Q: How many more acetyl CoA are generated from stearic acid than from linoleic acid during beta…
A: The process of beta oxidation of stearic acid yields two distinct products and these are acetyl-CoA…
Q: 6. When a concentrated alkali solution acts on the purine cycle, it breaks down? A. Ester group B.…
A: Purines are nitrogenous bases composed of two rings, which are fused together. Adenine and guanine…
Q: For carbohydrates to be converted to energy, it undergoes the process of metabolism, where in the…
A: Carbohydrates are major energy source of human beings. It is most important component of our diet .…
Q: In which of the following pairs Is the first eleme than the second? (1 Point) O 0, P O Cs, Rb O I,…
A: Electronegativity - It is property of an atom in a molecule. The tendency of an atom to attract the…
Q: As listed in the LIPID MAPS Structure database, a synonym for 18:2w-3 using the (n-x) nomenclature…
A: LIPID MAPS computationally-generated database of "bulk" lipids.
Q: Consider this intermediate in the derivation of the Michaelis-Menten equation. [E] [S] k-1 + k2 [ES|…
A: Km : The concentration of substrate at which enzyme achieves half Vmax-maximum velocity
Q: (a) Draw the condensed structural formula, and give the name and abbreviation for the dipeptide…
A: Dipeptide is the structure formed by two aminoacids with a single Peptide bond. Anomeric carbon is…
Q: What is the purpose of acrylamide and bis-acrylamide? in SDS-Page Gel
A: Sodium dodecyl sulphate-Polyacrylamide gel electrophoresis (SDS-PAGE) is a common analytical…
Q: Please solve all part. 9. If 32p-labeled inorganic phosphate were…
A: Glycolysis is undergoing here i.e conversion of the glucose to pyruvate molecules, and we assume…
Q: Self-splicing introns are called ribosomes splicing enhancers ribozymes intron silencer
A: Self splicing introns : These can catalyze their own excision from the mRNA, the tRNA, rRNA…
Q: 2. Complete and identify the enzymes involved in the following pathways OydroyacetoreP tructose…
A: The glycolytic pathway helps to metabolize glucose molecules obtained through the diet, glycogen…
Q: In the RBCs of the patient in the picture, which of the following would be expected? Explain. A.…
A: Red blood cells (RBCs) are the blood cells, which help to carry oxygen from the lungs to the tissues…
Q: DNA scissors used in genetic engineering applications are called Endo nucleases Restriction enzymes…
A:
Q: Explain the difference between saturated and unsaturated fats.
A: The chemistry of the triacylglycerols determine their physical properties.
Q: HbA1c is a glycated hemoglobin in which a glucose molecule is covalently bound to the N-terminal…
A: Hemoglobin is an iron-containing oxygen-transport metalloprotein found in nearly all vertebrates'…
Q: find stereochemistry, (from the structure) , rotational bond and geometrical / optical isomer for…
A: Phenyotin is a synthetic compound and also called Diphenylhydantoin and it is a potent…
Q: What is the relationship between the cooling of organs and tissues for medical transplants and the…
A: For patients with end-stage disease, organ transplantation is the most effective therapy. Donor…
Q: mg/L of cell tissue and 10 mg/L of ammonia
A: TKN is refers to the term Total Kjeldahl Nitrogen which is defined as the total concentration of…
Q: Which of the following statements are TRUE? Multiple answers are accepted for this question a .Two…
A: Two answers are correct
Q: Explain in detail the role of biotechnology in production of baker’s yeast.
A: For millennia, humans have used the metabolic activity of yeasts in baking and brewing. The creation…
Q: In the structure of vancomycin, what moiety contributes to its solubility in polar medium?
A: Vancomycin is a glycopeptide antibiotic and kills gram-positive bacteria such as…
Q: Write the metabolism (phase 1 & phase 2) of Phenoxybenzamin
A: Phenoxybenzamine is an alpha-adrenergic antagonist with long duration of action because of longer…
Q: RNA Pol III transcribes the following class of RNAS TRNAS rRNAs small nuclear RNAS All of the above
A: RNA pol III :- eukaryotic RNA polymerase, help in eukaryotic transcription.
Q: What is the difference between Raman Spectroscopy and SERS ( Surface Enhanced Raman Spectroscopy).
A: Introduction: It is the most powerful tool to study the interactions between matter and…
Q: dehydrogenase, which converts pyruvate to lactate in the presence of NADH. The velocity of the…
A: Kcat is also known as catalytic constant or turnover number. It can be defined as the amount of…
Q: Why is it necessary to study the diffusion of molecules in biological systems? (а.) To understand…
A: Diffusion is the process of random motion of molecules in which there is a net flow of matter from a…
Q: If 100% of the free energy from the metabolism of glucose is used for the conversion of ADP to ATP,…
A: The equation for the oxidation of glucose is:
Q: Which of the following processes generates the most ATP? (Account for the no. of ATP) a. ) Citric…
A: The human body is a complex system that requires energy to operate effectively. At the cellular…
Q: 2. Which enzyme is used in the estimation of glucose from the blood sample using biosensors? a.…
A: Biosensors are device used that calculates measurable signal for a particular test. Pregnancy tests…
Q: What does protein function in the human body?
A: Proteins are made up of amino acids or we can say that amino acids are the building block of…
Q: What is cryopreservation? How do we reduce the risk of cell damage from osmolytic pressure in…
A: Cryopreservation is primarily used to preserve biological specimens. Individual cells and biological…
Q: In bullet form, what are the salient features and functions of steriods? Salient features of…
A: Steroids are biologically active compounds. Steroids are found in plants, animals and fungi.…
Q: te the structure for a generic triacylglyceride at pH 7.4.
A: ''Since you have asked multiple question , we will solve the first question for you . If you want…
Q: Succinyl-CoA Synthetase mechanism Succinyl-CoA synthetase enzyme active site O Substrates bind to…
A: Succinyl-CoA-Synthetase: This is an enzyme of TCA cycle catalyze the conversion of Succinyl-CoA to…
Q: Loss of function mutation results in a _ allele.
A: Mutations are sudden changes in the gene sequence. When these changes causes loss of function of an…
Q: Look at tho structuros of tho blood group dotorminante. Red blood cell N-Acetyl- D-glucosamine Blood…
A: Blood group antigens are O-glycoproteins, N-glycoproteins, and glycolipids that are present on the…
Q: Draw and label a structure of: A diglyceride of oleic acid
A: A diglyceride is composed of a glycerol molecule attached to two fatty acids through ester bonds.…
Step by step
Solved in 2 steps
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Translate the mRNA sequence of HBs mRNA 5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU -3'015347/quizzes/5825797/take 21. The processing events that must occur on the MRNA after it is transcribed, but before it is released into the nucleus include (select all that apply) Primary RNA transcript Exon 1 Intron Exon 2 Intron Exon 3 RNA processing Spliced RNA Exon 1 Exon 2 Exon 3 AAAAAAA 5' cap Poly-A tail 3' untranslated region 5' untranslated region O folding into its functional shape O splicing out exons O adding a poly-A tail O removal of non-coding sections O capping the 5' end hp
- w/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdfA segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)Explain why mature mRNA transcripts is a different size that pre-mRNA transcripts. Be sure to include the name of the protein-ribonucleotide complex that’s involved.
- Which of the following enzymes is NOT utilized in mRNA degradation? MARK ALL THAT APPLY Primase Poly A Binding Protein deadenylases exoribonucleases endoribonucleasesExplain why the statement is correct. A section of the mRNA has a nucleotide sequence of CUATAUGUTGUU. How many codons does this segment of mRNA represent? none, this molecule is not an RNA transcript of DNAGiven the DNA sequence TATAGCACTGAT, which of the following is the correct complementary mRNA sequence that would be produced? TUTUCGUGUCTU AUAUCGUGACUA ATATCGTGACTA CGCATGTCAGC None of the above
- Give the single letter translation for the protein encoded by this mRNA. Start with the start codon. 5' M7GPPP- CCGACGUAUAUGGCGACUGAUCACUGACCAACGAAAA O ATDHXPTK OPTYMATDH MRAHVT O MATDH AAAAAA - 3'If the DNA sequence is 3’ ATCGACGTC 5’, what is the mRNA sequenceConsider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letter